Sym_mouse 0: Chr_mouse Alias Search_sym Sort_by_mouse_sym Map_ccr Map_mit Chr_band Locus_name Map_method Sym_human Chr_human Chr_hs_guess Comment Reference Ref_ccr Anchor_comp Chr_cat Chr_cow Chr_deermus Chr_dog Chr_fox Chr_hamster Chr_horse Chr_mink Chr_mouse_predicted Chr_pig Chr_rabbit Chr_rat Chr_sheep Comp_note Cosmid_hsa Cosmid_mmu Enzyme Genbank Gene_note Is_129 Is_a Is_akr Is_balbc Is_c3h Is_c57bl6 Is_dba2 Is_sjl Locus_type Map_gbase Map_cm_hsa Map_mb_has Flpter_hsa Map_note Map_panel Mit_a Mit_akr Mit_assay Mit_c57bl6 Mit_balbc Mit_c3h Mit_cast Mit_dba2 Mit_ob Mit_lp Mit_nod Mit_non Mit_spr Neighbor_cen Neighbor_tel Panel_name Phenotype Primer Repeat_info Ri_axb_bxa Ri_akxd Ri_akxl Ri_bxd Ri_bxh Ri_bxj Ri_cxb Ri_cxj Ri_cxs Ri_lxp Ri_nx8 Ri_nx9 Ri_nxsm Ri_oxa Ri_swxj Ri_swxl Yac_hsa Yac_mmu Year Sort_by_group Sort_by_human_chr Sort_by_human_sym Status 3/31/93 12/1/94 Jax_number Accession_mdb A000001 Aat3 RW Alpha-1 PI-3 aat3 Aat003 alpha 1 antitrypsin 3 Title of PNAS paper by Borriello & Krauter 1991: Multiple murine alpha-1 protease inhibitor gens show unusual evolutionary divergence. Borriello F 1991 PNAS 88:9417 M75720 1366 nt mRNA sequence. D 1991 RW personal 8/10/94 R111142 Aat4 RW Alpha-1 PI-4 aat4 Aat004 alpha 1 antitrypsin 4 Title of PNAS paper by Borriello & Krauter 1991: Multiple murine alpha-1 protease inhibitor gens show unusual evolutionary divergence. Borriello F 1991 PNAS 88:9417 M75718 1381 nt mRNA sequence. D 1991 RW personal 8/10/94 R111143 Aat5 RW Alpha-1 PI-5 aat5 Aat005 alpha 1 antitrypsin 5 Title of PNAS paper by Borriello & Krauter 1991: Multiple murine alpha-1 protease inhibitor gens show unusual evolutionary divergence. Borriello F 1991 PNAS 88:9417 M75717 1372 nt mRNA sequence. D 1991 RW personal 8/10/94 R111144 Abo RW abo Abo alpha 1-3-N-actylgalactosaminyltransferase ABO 9q34.1-q34.2 ABO human blood group locus. 183.5 1994 RW personal 12/15/94 12/15/94 R115261 Abr RW abr Abr active BCR related gene ABR 17p13.3 A human gene associated with medulloblastoma. Heisterkamp N 1989 Nucleic Acids Res 17:8821 & Heisterkamp N 1993 J Biol Chem 268:16903 & McDonald JD 1994 Genomics 23:229 1994 RW personal 9/17/94 10/17/94 R114075 Acadsb RW acadsb, sbcad acyl-CoA dehydrogenase, short/branched ACADSB Rozen R 1994 Genomics 24:280 U12778 (Hsa) 1994 RW personal 1/22/95 1/22/95 R115303 Acg RW acg Acg anticoagulant protein Sequence data in rat and human. Symbol is just a placeholder. Get proper symbol. M21730 (Rno), M18366 (Hsa) 1994 RW personal 8/29/94 8/29/94 R113931 Acrb3 RW Acrb-4 acrb3, chrnb3 Acrb003 acetylcholine receptor, beta 3 CHRNB3 8p11.2 Human nicotonic acetylcholine receptor subunit may have a mouse homolog. Koyama K 1994 Genomics 21:460 61 B D brain (transmitter related) 1994 RW personal 8/10/94 10/7/94 R113645 Acro RW MUSAG acro Acro acrogranin Acrogranin is an acrosomal cysteine-rich glycoprotein and is the precusor of the growth-modulating peptides, granulins, and epithelins. Expressed in somatic as well as male germ cells. Reserved by RW provisional, check with GBASE. Baba T 1993 Mol Reproduction Development 34:233 M86736 D 1993 RW personal 8/10/94 R111146 Acta2 RW acta2 Acta002 actin, alpha 2 ACTA2 10q22.3-q23.1 The human ACTA2 gene. Relationship to the mouse actin genes not known (Aug 94) to RW. Mouse symbol is just a placeholder. Check with Mouse Nomenclature Committee. Ueyama 1990 CRI-JS8027, CRI-JS8069 K01741 (Hsa) JY4035, JY4053 1990 RW personal 9/12/94 10/17/94 R114060 Actn1 RW actn1 Actn001 actinin, alpha 1 ACTN1 14q24.1-q24,2 Cytoplasmic membrane-associated protein. Binds to integrin beta1 cytoplasmic domain and vinculin. Binds to actin and cross-links actin filaments. Binds calcium. Reserved by RW. Mapped in human. Refs and GenBank accession for human. Cutting GR 1988 Mol Biol Med 5:173 & Millake DB 1989 Nucleic Acids Res 17:6725 & Youssoufian H 1990 Am J Hum Genet 47:62 X15804 (Hsa), M31300 (Hsa), M95178 (Hsa) D 1993 RW personal 8/10/94 R111147 Actn2 RW actn2 Actn002 actinin, alpha 2 ACTN2 1q42-q43 Cytoplasmic membrane-associated protein. Binds to integrin beta1 cytoplasmic domain and vinculin. Binds to actin and cross-links actin filaments. Binds calcium. Reserved by RW. Mapped in human. Refs and GenBank accession for human. Beggs AH 1992 Genomics 13:1314 M86406 (Hsa), M86804 (Hsa) D 1993 RW personal 8/10/94 R111148 Actn3 RW actn3 Actn003 actinin, alpha 3 ACTN3 11q13-q14 Cytoplasmic membrane-associated protein. Binds to integrin beta1 cytoplasmic domain and vinculin. Binds to actin and cross-links actin filaments. Binds calcium. Reserved by RW. Mapped in human. Refs and GenBank accession for human. Smith MW 1993 Genomics 17:699 M86407 (Hsa) D 1993 RW personal 8/10/94 R111149 Acvr2 RW ActR-II acvr2, actrii Acvr002 activin receptor type 2 Receptor of both Tgfb and activin. Formed by heteromeric complex of type 1 and type 2 subunits. Type 2 is a serine-threonine kinase. Important role in early neural induction. Blocking this receptor turns prospective epidermis into neural tissue. Hemmati-Brivanlou A 1994 Cell 77:273 & Matzuk M 1992 Biochem Biophys Res Comm 000:000 M93400, M93399 activin receptor type II gene, 5' untranslated region. *Title* Structure of the mouse activin receptor type II gene protein (receptor) 1992 RW personal 8/10/94 8/20/94 R111150 Adh2 RW adh2 adh002 alcohol dehydrogenase 2 AHD2 4q21-q25 Mapped in human, cat mink, rat. Status in mouse is uncertain. O-5Brien lists as a mouse gene on Chr 3 with Adh1 and Adh3. Y B1 6 L6 8p12-p24 8 2 RW personal 8/10/94 3/26/94 R111734 Adipa RW MUSADIPA adipa Adipa adipogenic A Reserved by RW provisional. Check with GBASE. Symbol is from GenBank mnemonic. Colon-Teicher L 1993 Nucleic Acids Res 21:2223 L04495 Human or mouse adipogenic DNA fragment, clone A. *Title* Genomic sequences capable of committing mouse and rat fibroblasts to adipogenesis D 1993 RW personal 8/10/94 R111151 Adora2 RW adr Adora002 adenosine receptor, alpha 2a ADORA2 22 A high affinity G-protein coupled receptor mapped by in situ in human. Mouse gene not yet mapped. MacCollin M 1994 Genomics 20:332 1994 RW personal 8/10/94 8/1/94 R113639 Adta RW MUSADAPA adta Adta adaptin, alpha Coated vesicle protein. See related clathrin associated protein AP17, AP19, and AP47 (GenBank Accession M62418, M62419). Determine relationship of these proteins and their genes Robinson M 1989 J Cell Bio 108:833 X14971, X14972, U05686 (Mspretus), U05687 (Mspretus) mRNA for alpha-adaptin (A and C) *Title* Cloning of cDNAs Encoding Two Related 100-kD Coated Vesicle Proteins (Alpha-Adaptins) 1989 RW personal 8/10/94 9/10/94 R111152 Adtb RW adtb Adtb adaptin, beta A component of clathrin-coated vesicles associated with the golgi apparatus. Sequence data for both rat and human. M34176 (Rno), M34175 (Hsa) 1994 RW personal 8/28/94 8/28/94 R113930 Adtg RW MUSADAPG adtg Adtg adaptin, gamma A component of clathrin-coated vesicles associated with the golgi apparatus. See related clathrin associated protein AP17, AP19, and AP47 (GenBank Accession M62418, M62419). Determine relationship of these proteins and their genes Robinson M 1990 J Cell Bio 111:2319 X54424 mRNA for gamma adaptin *Title* Cloning and expression of gamma-adaptin, a component of clathrin-coated vesicles associated with the golgi apparatus 1990 RW personal 8/10/94 R111153 Aeg1 RW Aeg-1, MUSAEG1A aeg1 Aeg001 acidic epididymal glycoprotein 1 Mizuki N 1992 Mol Cell Endocrinol 89:25 M92849 acidic epididymal glycoprotein (Aeg-1) mRNA, complete cds. *Title* Mouse submandibular glands express an androgen-regulated transcript encoding an acidic epidydimal glycoprotein-like molecule 1992 RW personal 8/10/94 R111154 Aeg2 RW Aeg-2, MUSAEG2A aeg2 Aeg002 acidic epididymal glycoprotein 2 Mizuki N 1992 Mol Cell Endocrinol 89:25 M92850 acidic epididymal glycoprotein-like protein (Aeg-2) mRNA, complete cds. *Title* Mouse submandibular glands express an androgen-regulated transcript encoding an acidic epidydimal glycoprotein-like molecule 1992 RW personal 8/10/94 R111155 Aer RW aer Aer arginine esterase Temporary symbol of RW. Check whether this is one of the esterase (Es) genes. Sequence data from dog. Symbol based on GenBank mnemonic. Get reference 1993 RW personal 8/10/94 R111156 Aggr RW MUSAGGR aggr Aggr aggrecan Reserved by RW provisional. Check with GBASE. Fulop C 1993 J Bio Chem 268:17377 L07051 aggrecan mRNA exon. *Title* Expression of alternatively spliced epidermal growth factor-like domain in aggrecans of different species: evidence for a novel module D 1993 RW personal 8/10/94 R111157 Agxt RW agxt Agxt alanine-glyoxylate aminotrasferase AGXT 2q36-q37 Mapped in human and rat. Mouse homolog may map to Chr 1 or 2. In humans associated with oxalosis type 1, hyperoxaluria 1, glycolicacidauria. 9q34-q36 1994 RW personal 8/10/94 3/26/94 R111715 Akap79 RW akap79 akap079 A kinase anchor protein, 79 kDa Located in postsynaptic density. Forms a ternary complex with both the regulatory subunit of PKA or calcineurin and with protein phosphates 2B (calcineurin). Coghlan VM 1995 Science 267:108 1995 RW personal 1/22/95 1/22/95 R115282 Aldp RW MMADRLDR aldp, mmadrldr Aldp adrenoleukodystrophy Z33637 Z33637: 3421 bp mRNA sequence 1994 RW personal 8/8/94 8/8/94 R113765 Aldx RW aldx, ald Aldx adrenoleukodystroghy, X linked ADL Xq28-q28 Demyelinating disease brought about by a peroxisomal disorder in which very long chain fatty acid beta oxidation is disrupted. The gene is an ATP dependent (ABC) superfamily member membrane associated tranporter similar to PMP70. Sarde CO 1994 Genomics 22:13 Z31348 (Hsa), Z31006 (Hsa), Z31007 (Hsa), Z31008 (Hsa), Z31009 (Hsa), Z31010 (Hsa) Human gene of 10 exons spanning 21 kb. The human gene maps between DXS15 and L1CAM with 650 kb of opsin genes. 1994 RW personal nomenclature 9/12/94 9/12/94 R114062 Alk1 RW alk1, tsri, r3 Alk001 activin-like kinase 1 ALK1 Receptor-like serine-threonine kinase. Alk1 and Alk2 bind activin. Homolog of rat R-3. Mutant forms are associated with lymphoma. ten_Dijke P 1994 Science 264:101 & Morris SW 1994 Science 263:1281 1994 RW personal 8/10/94 8/22/94 R111911 Alk2 RW alk2, tsk7l, skr1, actr1, actri, r1 Alk002 activin-like kinase 2 ALK2 Receptor-like serine-threonine kinase. Alk2 bind activin with high affinity. Homolog of rat R-1. ten_Dijke P 1994 Science 264:101 1994 RW personal 8/10/94 5/30/94 R111912 Alk3 RW alk3 Alk003 activin-like kinase 1 ALK3 Receptor-like serine-threonine kinase. ten_Dijke P 1994 Science 264:101 1994 RW personal 8/10/94 5/30/94 R111913 Alk4 RW Tsk7l alk4, tsk7l Alk004 activin-like kinase 4 ALK4 Receptor-like serine-threonine kinase. Binds to activin with high affinity. Homolog of rat R-2. Ebner R 1993 Science 260:1344 & ten_Dijke P 1994 Science 264:101 1993 RW personal 8/10/94 5/30/94 R111914 Alk5 RW alk5 Alk005 activin-like kinase 5 ALK5 Receptor-like serine-threonine kinase. Functional Tgfb1 receptor for activation of plasminogen activator inhibitor 1. Homolog of rat R-4. ten_Dijke P 1994 Science 264:101 1994 RW personal 8/10/94 5/30/94 R111915 Alk6 RW alk6 Alk006 activin-like kinase 6 Receptor-like serine-threonine kinase. ten_Dijke P 1994 Science 264:101 cDNA from a E12 mouse embyro library. 502 aa sequence by ten_Dijke. 1994 RW personal 8/10/94 5/30/94 R111916 Aloxap RW aloxap, flap Aloxap arachidonate 5-lipoxygenase activating protein Vickers P 1992 Mol Pharmacol 000:000 M96554 1992 RW personal 8/10/94 R111159 Amt RW amt Amt aminomethyltransferase AMT 3p21.2-p21.1 Mapped in human. May have a mouse homolog on Chr 9 or 14. Also known as the T-protein of the glycine cleavage system, part of the mitochondrial multienzyme complex. Important in purine synethesis. Mutations in this gene associated in humans with hyperglycinemia. Die within a few weeks. Nanao K 1994 Genomics 19:27 2.1.2.10 1994 RW personal 8/24/94 10/7/94 R113805 Amy2-psX RW MUSAMYXPS, Amy-X amy2psX, amyx Amy002psX amylase 2, pseudogene X Not in GBASE. Provisionally reserved by RW based on sequence data. Name taken with modification from paper and GenBank. Hagenbuechle O 1985 J Mol Bio 185:285 X02949 D 1985 RW personal 8/10/94 R111160 Amyl RW amyl Amyl amylin Reserved provisionally by RW. Sequence data in dog. Check with GBASE. Albrandt K 1992 Biochim Biophys Acta 1130:97 (dog) X59998 (dog) 1993 RW personal 8/10/94 R111161 Anpra RW anpra anpra atrionatriuretic peptide receptor A / guanylate cyclase Hom ANPRA 1q21-q22 Mapped in human and rat. Mouse homolog may be on Chr 1 or 3. 2 RW personal 8/10/94 8/18/94 R111707 Anx2 RW anx2 Anx002 annexin 2 / lipocortin 2 May also be termed lipocortin II of lipocortin 2. M14044, M14043 (Hsa) Mouse and human sequence data for "lipocortin III" 1994 RW personal, nomenclature 9/1/94 9/1/94 R113960 Anx3 RW anx3 Anx003 annexin 3 / lipocortin 3 Hom ANX3 A human gene likely to have a mouse homolog. May also be termed lipocortin III of lipocortin 3. Confirm that annexin and lipocortin are synonyms. Tait JF 1993 Genomics 18:79 M20559 (Rno), M20560 (Hsa) Rat and human sequence data for "lipocortin III" 1994 RW personal, nomenclature 8/10/94 9/1/94 R111543 Anx5 RW anx5 Anx005 annexin 5 Hom ANX5 4q26-q28 Calcium-dependent phospholipid binding protein. A human gene likely to have a mouse homolog. Cookson BT 1994 Genomics 20:463 1994 RW personal 8/29/94 8/29/94 R113942 Ap13 RW ap13 Ap013 adipocyte specific protein, 13 kDa Developmentally regulated gene expressed in 3T3-adipocytes. Provisionally reserved by RW based on GenBank sequence data and description. Check with GBASE. Cook K 1985 J Cell Bio 100:514 M28726 13K protein mRNA, 3' end. *Title* Developmentally regulated mRNAs in 3T3-adipocytes: Analysis of transcriptional control 1985 RW personal 8/10/94 R111162 Appst RW appst, app Appst acid phosphatase, prostatic Symbol is just a temporary placeholder. M32397 (Rno), M24902 (Hsa) 1994 RW personal 9/7/94 9/7/94 R113989 Aqua1 RW CHIP28 chip28, wchcd Aqua002 aquaporin 1 A water selective channel responsible for high water permeability in proximal tubule and loop of Henle. Temporary symbol by RW. Fushimi K 1993 Nature 361:549 & Deen PMT 1994 Science 264:92 & Moon C 1993 J Biol Chem 268:15772 1994 RW personal 8/10/94 5/30/94 R111918 Aqua2 RW ndi, wchcd Aqua002 aquaporin 2 NDI 12 A vasopressin-dependent water channel expressed in collecting duct of kidney. Essential for urine concentration. Sequenced in rat and human. Associated with nephrogenic diabetes insipidus. Temporary symbol by RW. Fushimi K 1993 Nature 361:549 & Deen PMT 1994 Science 264:92 Z29491 (Hsa) rat cDNA probe also available. 1994 RW personal 8/10/94 5/30/94 R111917 Asns RW asns Asns asparagine synthetase Hom ASNS 7q21-q31 Mapped in human and hamster. Possible mouse homolog. Chr 5 is the best candidate for the homolog (RW Mar 94). 1 1994 RW personal 8/10/94 11/10/94 R111751 Asp RW Asp Asp aspartoacylase ASP Human gene that catalyzes the hydrolysis of N-acetyl-L-aspartic acid. May have a mouse homolog. In humans, associated with Canavan disease--spongy degeneration of the brain. Autosomal recessive leukodystrophy. Sequenced in cow also. Kaul R 1993 Nature Genet 5:118 3.5.1.15 Human sequence of 1435 bp, 313 aa product, single potential N-glycosylation site, 5 putative phosphorylation sites, 3 catalytic domain sequences typical of esterases. RW personal 8/10/94 3/24/94 R111609 Aspat RW aspat Aspat aspartate aminotransferase Get human symbol and use instead of Aspat (RW placeholder) J02622, M22632 (Hsa) 1994 RW personal, nomenclature 8/29/94 8/29/94 R113933 Aspsa2 RW aspsa2 Aspsa002 aspartyl-tRNA synthetase alpha 2 Symbol is just a placeholder by RW. Get human and rat symbol. J04487 (Rno), J05032 (Hsa) 1994 RW personal, nomenclature 8/29/94 8/29/94 R113934 Ass-ps3 RW assp3 Assps003 argininosuccinate synthetase pseudogene 3 ASSP3 9q11-q22 A human ASS pseudogene that might have a murine homolog on Chr 19. The mouse symbol is just a placeholder. 19 93 Human gene only. 1994 RW personal 12/15/94 12/15/94 R115262 Atfc RW C/ATF atfc, catf Atfc activating transcription factor C A member of the activating transcription factor family of DNA binding proteins that dimerizes with CAAT/enhancer-binding proteins and directs their binding. Vallejo M 1993 PNAS 90:4679 L13791 D clone Chop11 of Vallejo et al 1993 1993 RW personal 8/10/94 R111163 Bap29 RW bap29 Bap029 B cell receptor associate protein 29 Kim KM 1994 EMBO J 13:3793 & Terashima M 1994 EMBO J 13:3782 X78684 1993 RW personal 10/6/94 10/6/94 R114177 Bap32 RW bap32 Bap032 B cell receptor associate protein 32 Terashima M 1994 EMBO J 13:3782 X78682 1993 RW personal 10/6/94 10/6/94 R114178 Bap37 RW bap37 Bap037 B cell receptor associate protein 37 Terashima M 1994 EMBO J 13:3782 X78683 1993 RW personal 10/6/94 10/6/94 R114179 Bax RW bax Bax B cell lymphoma 2 opposer, Bax Involved in the survival of lymphocytes. Binds Bcl2 product. Promotes cell death. Bax product may shield the Bcl2 dimer and inactivate it (Morgan JI, personal communication, Dec 1994) Oltvai ZN 1993 Cell 74:609 & Barinaga M Science 263:754 1993 RW personal 8/10/94 12/13/94 R111164 Bclx RW Bcl-x bclx Bclx B cell lymphoma 2 like gene A Bcl2 related gene that functions as a dominant regulator of apoptotic cell death on lymphocytes. Long product protective; short product a killer. May be the same locus as Bcl2l. Craig Thompson has knock-out mouse in progress (Feb 94). Boise LH 1993 Cell 74:597 & Barinaga M Science 263:754 1993 RW personal 8/10/94 R111165 Bcn RW bcn Bcn betacellulin A mitogen expressed in pancreatic beta tumor cells. Shing Y 1993 Science 259:1604 L08394 mRNA complete cds. D 1993 RW personal 8/10/94 R111166 Bgbp RW bgbp Bgbp beta galactosidase binding protein An autocrine negative, cytostatic growth factor. Wells V 1991 Cell 64:91 M57470 mRNA sequence D 1991 RW personal 8/10/94 R111167 Bif RW bif,pbif Bif enoyl-CoA hydratase:3-hydroxyacyl-CoA dehydrogenase bifunctional enzyme 3q26.3-q28 79 kDa. One of four enzymes involved in the peroxisomal beta-oxidation of fatty acids. In rat this enzyme also has isomerase activity and therefore sometimes referred to as the trifunctional enzyme. Get the HGMW approved human symbol. Hoefler G 1994 Genomics 19:60 L07077 (Hsa) L07077: 3779 nt with and ORF of 2169 nt coding for 723 aa. 1994 RW personal, nomenclature 8/24/94 10/17/94 R113806 Bmd RW bmd Bmd Best's macular dystrophy BMD 11q13 A human disease gene. Autosomal dominant. MIM 153700. Abnormal accumulation of lipofuscin in retinal pigment epithelium. Also known as Best's vitelliform macular dystrophy. Mouse proximal Chr 19 is the best candidate interval. Graff C 1994 Genomics 24:425 19 In human maps to a 6 cM interval between FCERI and D11S480 and ROM1. Probably quite close to ROM1. Also linked to PGYM in human. 1994 RW personal 1/17/95 1/17/95 R115278 Bnp RW bnp Bnp brain natriuretic protein Reserved provisionally by RW. Check with GBASE. Based on dog sequence data. Get reference 1993 RW personal 8/10/94 R111168 Brca1 RW brca1 Brca001 breast cancer 1 BRCA1 17q12-q21 Kelsell DP 1993 Hum Mol Genet 2:1823 & Smith SA 1993 Am J Hum Genet 52:767 & Peltoketo H 1994 Genomics 23:250 Predicted to be linked to Krt1.14 on mouse Chr 11 at about 56 cM. 1994 RW personal 9/18/94 9/18/94 R114079 Btd RW btd Btd biotinidase, serum BTD 3p25-p25 Recycles the vitamin biotin by catalyzing the hydrolysis of biocytin. Cole H 1994 Genomics 22:662 3.5.1.12 1994 RW personal 9/11/94 9/11/94 R114059 C1r RW c1r c001r complement component 1, r subcomponent Hom C1R 12p13 Mapped in human and sheep. A mouse homolog might be expected to map to Chr 6 (RW Mar 94). 3q 1994 RW personal 8/10/94 8/18/94 R111739 C9 RW c9 c009 complement component 9 Hom C9 5p14-p12 Mapped in human and cow and pig. Possible mouse homolog, perhaps on Chr 15. 1 16 1994 RW personal 8/10/94 8/18/94 R111741 Cad RW cad Cad carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihyroorotase Hom CAD 2p22-p21 Mapped in human and hamster. Probably has a mouse homolog on Chr 12. Symbol assigned by RW. Old Cad symbol (congenital cataract) assigned new symbol Concat. 7q 12 1994 RW personal 8/10/94 9/18/94 R111713 Cagbpa RW cagbpa Cagbpa CArG binding factor A Symbol is just a temporary placeholder. Get correct symbol from GDB. Sequenced in mouse and human. D90151, M65028 (Hsa) 1994 RW personal 8/29/94 8/29/94 R113936 Calbp RW calbp Calbp calmodulin binding protein, alpha fodrin Provisional. Check sequence data. RW personal. Sri J 1988 Nucleic Acids Res 000:000 X12801 D 1988 RW personal 8/10/94 R111169 Calseq RW calseq Calseq cardiac calesquestrin Provisionally reserved by RW based on dog sequence data. Check with GBASE. Symbol by RW. Get reference 1993 RW personal 8/10/94 R111170 Catnf1 RW catnf1, cat1 catnf1 carnitine acyl-transferase 1 CAT1 9q34.1-q34.1 Mouse symbol is just a temporary placeholder. Mapped in human. Presumably has a mouse homolog. There is a nomenclature comflict between CAT1 and Cat1 in human and mouse. Corti O 1994 Genomics 23:94 2.3.1.7 X78706 (Hsa) 1994 RW personal, nomenclature 9/17/94 10/7/94 R114072 Catng RW catng Catng catenin, gamma Binds to cytoplasmic domain of cadherins and to desmoglein. May be the same as plakoglobin (Plko). protein (membrane) 1993 RW personal 8/10/94 9/18/94 R111172 Ccnf RW ccnf cyclin F CCNF 16p13.3 Maps in the region of the polycystic kidney disease. Kraus B 1994 Genomics 24:27 Z36714 (Hsa) 17 exons in human. 1994 RW personal 11/29/94 11/29/94 R115235 Cd36 RW cd36 Cd036 cluster designation 36 antigen A receptor for oxidized low density lipoprotein. Endemann G 1993 J Bio Chem 268:11811 L23108 D 1993 RW personal 8/10/94 R111173 Cd73 RW cd73 Cd073 cluster designation 73 antigen Ecto-5'nucleotidase Resta R 1993 Gene 00:00 L12059 mRNA complete cds D 1993 RW personal 8/10/94 R111174 Cdc25a RW cdc25a Cdc025a cell division cycle control protein 25A CDC25A 3p21 Protein tyrosine phosphatase that removes phosphatase from tryosine 15 of the major M phase kinase, CDC2. Human locus near a karyotype abnormality site associated with lung and kidney cancers. CDC25 split into A, B, and C loci by RW . May have a mouse homolog on Chr 9 or 14. Wei W 1992 PNAS 89:7100 M91816, L20899 D enzyme (phosphatase) 1992 RW personal 8/10/94 10/7/94 R111175 Cdc25b RW cdc25b Cdc025b cell division cycle control protein 25B CDC25B 20p13 Protein tyrosine phosphatase that removes phosphatase from tryosine 15 of the major M phase kinase, CDC2. CDC25 split into A, B, and C loci by RW based on human data enzyme (phosphatase) 1993 RW personal 8/10/94 R111176 Cf10 RW cf10, f10 cf010 coagulation factor 10 Hom F10 13q34 Mapped in human and cow. A mouse homolog might be expected on Chr 14. Y U27 1994 RW personal 8/10/94 8/18/94 R111753 Cf13a1 RW cf13a1, f13a1 Cf013a001 coagulation factor 13, A1 Hom F13A1 6p24.2-p23 Mapped in human and horse. May have mouse homolog, possibly on Chr 13 or 17. Y 20 1994 RW personal 8/10/94 8/18/94 R111746 Cf8ap RW cfap Cf008ap coagulation factor 8 associated protein Comparable gene in human Levinson B 1992 Genomics 13:862 M83118 D 1992 RW personal 8/10/94 R111177 Cf8vwf RW Cf8vwf cf8vwf, f8vwf Cf008vwf coagulation factor 8 von Willebrand factor Hom F8VWF 12p13.3-p13.2 Mapped in human, and cow. Possible mouse homolog. Chr 6 is a good candidate. 5 RW personal 8/10/94 8/18/94 R111738 Chh RW chh Chh cartilage-hair hypoplasia CHH 9p21-p13 A human autosomal recessive disorder characterized by disproportinate short stature, joint laxity, and fine sparse hair, and HirschsprungÕs disease. May be a defect of cell proliferation. Salisalo T 1994 Genomics 20:347 In humans map close to D9S163. Mouse homolog may map to Chr 4 at about 20 cM. Test linkage to Ggtb1. 1994 RW personal 8/28/94 10/17/94 R113928 Chr RW chr Chr chromate resistance, sulfate transport Hom CHR 5q35 Mapped in human and hamster. Mouse homolog likely to map to Chr 18. 2q 1994 RW personal 8/10/94 10/17/94 R111745 cKiras RW cKi-ras, c-Ki-ras, MUSCKIRAS ckiras cKiras cellular Ki-ras proto-oncogene cellular Ki-ras gene containing Friend virus proviral promoter. H-DNA and Z-DNA regions. Hoffman E 1987 Mol Cell Biol 7:2592 & George D 1989 Nucleic Acids Res 17:9259 & Pestov D 1991 Nucleic Acids Res 19:6527 X15887, M16708 cKi-ras gene containing Friend virus proviral promoter *Title* Transcriptional Activation of cKi-ras Proto-Oncogene Resulting From Retroviral Promoter Insertion D 1987 RW personal 8/10/94 R111178 Ckmt2 RW ckmt2 Ckmt002 creatine kinase, mitochondrial 2 CKMT2 5q13.3 Sacromere-specific mitochrondrial isoenzyme. Keeps ATP concentration constant by reversible storage of phosphate groups in phosphocreatine. Octameric protein composed of 4 homodimers. Expressed only in cardiac and striated muscle. 2.7.2. J05401 (Hsa), X69766 (Hsa) Sequenced in human: 37 kb gene with 11 exons. Near gene for proximal spinal muscular atrophy enzyme (kinase); human (disease locus proximity) PCR primers for human CKMT2 see Richard I 1993 Genomics 18:134 1990 RW personal 8/10/94 R111179 Clta RW clta clta clathrin light chain alpha CLTA 12q23-q24 About 29 to 33 kDa protein. Check relation to adaptin alpha (Adta). Ponnambalam S 1994 Genomics 24:440 M15882 (Rno), M20471 (Hsa) 1994 RW personal 8/29/94 1/17/95 R113938 Cltb RW clcb cltb clathrin light chain beta CLTB 4q2-q3 About 29 to 33 kDa protein. Check relation to adaptin beta (Adtb). Ponnambalam S 1994 Genomics 24:440 M15883 (Rno), M20469 (Hsa) 1994 RW personal 8/29/94 1/17/95 R113937 Cnbr RW cnbr Cnbr cannoabinoid receptor Get proper symbol. This symbol is only a placeholder. Sequence data in rat and human. X55812 (Rno), X54937 (Hsa) 1994 RW personal 8/29/94 8/29/94 R113935 Cnpd RW MUSCNPA cnpd, muscnpa Cnpd 2',3'-cyclic nucleotide 3'-phosphodiesterase May have another name and symbol. This symbol is just a placeholder. Get human symbol from GDB. Monoh K 1989 Biochem Biophys Res Commun 165:1213 3.1.4.37 M31810, M19650 (Hsa), D13144 (Hsa) 2900 nt murine sequence, 400 aa product 1989 RW personal 8/30/94 10/17/94 R113943 Cntn1 RW Ncsp-F3 cntn1, ncspf3, gp135 Cntn001 contactin 1 CNTN1 12q11-q12 A neuronal cell surface protein, F3A phoshatidylinositol-anchored member of the immunoglobulin superfamily related to chicken contactin/F11. Binds to tenascin, NG-CAM. Putative role in axon outgrowth. Expressed in adult brain, cerebellum. In human close to the Stickler syndrome region. Ranscht B 1988 J Cell Biol 107:1561 & Gennarini G 1989 J Cell Biol 109:775 & Faivre-Sarrailh C 1993 J Neurosci 12:257 & Berglund EO 1994 Genomics 21:571 15 X14943 (Hsa) mRNA sequence.' Human contactin composed of 6 C2 Ig domains and 4 fibronectin type 3 repeats. D Mouse homologue might map to Chr 15 at about 50-60 cM, perhaps linked to Krt2.1 and Itga5. 1988 RW personal 8/10/94 9/19/94 R111273 Coch5b2 RW coch5b2 Coch005b002 cochlea specific gene 5b2 High level of expression in fetal human cochlea. This gene has not been mapped in human. May have a mouse homolog. Contains a von Willebrand factor A like domain. Three transcript sizes in human. Little or no expression, except in cochlea (hight) and eye and brain (low). Robertson NG 1994 Genomics 23:42 1994 RW personal 9/16/94 10/7/94 R114068 Col13a1 RW Col3a-1 col13a1 Col013a001 procollagen type 13, alpha 1 COL13A1 10q21.2-q22.1 Human gene that may have mouse homolog. Y 2q12-21 CRI-JS8073 M20803 (Hsa) D protein (structural) JY4009 1985 RW personal 9/12/94 10/7/94 R114061 Cotnf RW cot Cotnf carnitine octanoyltransferase COT Bieber LL 1983 The Enzymes 16:627 1994 RW personal 9/17/94 9/17/94 R114073 Cox4-ps1 RW cox4ps1, cox4p, cox4l1 Cox004ps001 cytochrome c oxidase subunit 4, pseudogene 1 Hom COX4P, COX4L1 14q21-qter Mapped in human and cow. Possible mouse homolog. No strong candidates from current homology data, although Chr 14 and 12 are possible (RW Mar 94). 5 1994 RW personal 8/10/94 8/18/94 R111754 Cox6a RW cox6a Cox006a cytochrome C oxidase, subunit 6a Expressed in mouse embyros. Liver-type isoform. Grossman L 1992 Mol Reproduct Develop 000:000 L06465 D 1992 RW personal 8/10/94 R111181 Cox7c1 RW cox7c1 Cox007c001 cytochrome C oxidase, subunit 7c1 Akamatsu M 1990 Nucleic Acids Res 18:3645 X52940 D 1990 RW personal 8/10/94 R111182 Cpas2 RW cpas2 Cpas002 coupling protein alpha s2 Sequenced in human and mouse. Symbol is just a temporary placeholder. Get human gene symbol from GDB. Y00703, X04408 (Hsa) 1994 RW personal 8/29/94 8/29/94 R113939 Cps1 RW cps1 cps001 carbamoyl-phosphate synthetase 1, mitochondrial Hom CPS1 2p Mapped in human and rat. May have mouse homolog on Chr 1 or 6. 9 1994 RW personal 8/10/94 8/18/94 R111714 Crisp1 RW MUSCRISPA crisp1 Crisp001 cysteine-rich secretory protein 1 Expressed under androgen control in the mouse salivary gland. DE/AEG. Haendler B 1993 Endocrinology 133:192 L05559 D 1993 RW personal 8/10/94 R111183 Crisp3 RW MUSCRISPB crisp3 Crisp003 cysteine-rich secretory protein 3 Expressed under androgen control in the mouse salivary gland . Haendler B 1993 Endocrinology 133:192 L05560 D 1993 RW personal 8/10/94 R111184 Crs4c1 RW crs4c1 Crs004c001 cryptdin-related sequence 4C gene 1 One of several related genes expressed in Paneth cells of intestinal crypts. Not a defensin. Product about 10 kDa. Huttner KM 1994 Genomics 24:99 2 exons 1994 RW personal 11/30/94 11/30/94 R115238 Crs4c1a RW crs4c1a Crs004c001a cryptdin-related sequence 4C gene 1 One of several related genes expressed in Paneth cells of intestinal crypts. Not a defensin. Product about 10 kDa. Huttner KM 1994 Genomics 24:99 2 exons 1994 RW personal 11/30/94 11/30/94 R115244 Crs4c1b RW crs4c1b Crs004c001b cryptdin-related sequence 4C gene 1b One of several related genes expressed in Paneth cells of intestinal crypts. Not a defensin. Product about 10 kDa. Huttner KM 1994 Genomics 24:99 2 exons 1994 RW personal 11/30/94 11/30/94 R115245 Crs4c1c RW crs4c1c Crs004c001c cryptdin-related sequence 4C gene 1c One of several related genes expressed in Paneth cells of intestinal crypts. Not a defensin. Product about 10 kDa. Huttner KM 1994 Genomics 24:99 2 exons 1994 RW personal 11/30/94 11/30/94 R115246 Crs4c2 RW crs4c2 Crs004c002 cryptdin-related sequence 4C gene 2 One of several related genes expressed in Paneth cells of intestinal crypts. Not a defensin. Product about 10 kDa. Huttner KM 1994 Genomics 24:99 2 exons 1994 RW personal 11/30/94 11/30/94 R115239 Crs4c2a RW crs4c2a Crs004c002a cryptdin-related sequence 4C gene 2a One of several related genes expressed in Paneth cells of intestinal crypts. Not a defensin. Product about 10 kDa. Huttner KM 1994 Genomics 24:99 2 exons 1994 RW personal 11/30/94 11/30/94 R115243 Crs4c3 RW crs4c3 Crs004c003 cryptdin-related sequence 4C gene 3 One of several related genes expressed in Paneth cells of intestinal crypts. Not a defensin. Product about 10 kDa. Huttner KM 1994 Genomics 24:99 2 exons 1994 RW personal 11/30/94 11/30/94 R115240 Crs4c4 RW crs4c4 Crs004c004 cryptdin-related sequence 4C gene 4 One of several related genes expressed in Paneth cells of intestinal crypts. Not a defensin. Product about 10 kDa. Huttner KM 1994 Genomics 24:99 2 exons 1994 RW personal 11/30/94 11/30/94 R115241 Crs4c4a RW crs4c4a Crs004c004a cryptdin-related sequence 4C gene 4a One of several related genes expressed in Paneth cells of intestinal crypts. Not a defensin. Product about 10 kDa. Huttner KM 1994 Genomics 24:99 2 exons 1994 RW personal 11/30/94 11/30/94 R115242 Cryg8 RW cryg8 Cryg008 crystallin gamma 8 Hom CRYG8 3 Mapped in human and cow. May be mouse homolog. 1 1994 RW personal 8/10/94 8/18/94 R111730 Cryp RW cryp Cryp cryptdin Huttner KM 1994 Genomics 21:448 U02995, U02996, U02997, U02998, U02999, U03000, U03001 RW personal 8/10/94 8/1/94 R113635 Csn1s1 RW csn1s1 Csn001s001 casein 1 alpha s1 CSN1S1 4q Ovine and bovine gene. Check nomenclature in other mammals and relationship to CSNA and CSNB. There are four tightly (within 200 kb) linked casein genes on Chr 6 of the sheep. They are CSN1S1, CSN1S2 (the alpha s1 and s2 genes) and CSN2 (the beta gene), and CSN3 (the kappa gene). CSN2= CSNB. Montgomery GW 1994 Genomics 22:148 6q31-q33 4q12 6q23-q31 1994 RW personal, nomenclature 9/20/94 9/21/94 R114104 Csn1s2 RW csn1s2 csn001s002 casein 1 alpha s2 CSN1S2 4q Ovine and bovine gene. Check nomenclature in other mammals and relationship to CSNA and CSNB. There are four tightly (within 200 kb) linked casein genes on Chr 6 of the sheep. They are CSN1S1, CSN1S2 (the alpha s1 and s2 genes) and CSN2 (the beta gene), and CSN3 (the kappa gene). CSN2= CSNB. Montgomery GW 1994 Genomics 22:148 6q31-q33 4q12 6q23-q31 1994 RW personal, nomenclature 9/21/94 9/21/94 R114105 Csn3 RW csn3 csn001s002 casein, kappa CSN3 4q Ovine and bovine gene. Check nomenclature in other mammals and relationship to CSNA and CSNB. There are four tightly (within 200 kb) linked casein genes on Chr 6 of the sheep. They are CSN1S1, CSN1S2 (the alpha s1 and s2 genes) and CSN2 (the beta gene), and CSN3 (the kappa gene). CSN2= CSNB. Montgomery GW 1994 Genomics 22:148 6q31-q33 4q12 6q23-q31 1994 RW personal, nomenclature 9/21/94 9/21/94 R114106 Cst RW cst Cst cystatin Need to investigate relation between this sequence and Cst3 of Huh C 1994. Solem M 1990 Biochem Biophys Res Comm 172:945 M59470 mRNA complete cds. D 1990 RW personal 8/10/94 8/6/94 R111185 Cst3 RW cst3 Cst003 cystatin 3 Also known as cystatin C. Huh C, Nagle JW, Kozak CA, Abrahamson M, Karlsson S 1994 Structural organization, expression and chromosomal mapping of the mouse cystatin C gene, Unpublished as on Jun 7, 1994. Huh C 1994 unpublished U10098 6125 bp DNA sequence D Cst3 was mapped by Huh, Nagle and Kozak in 1994. 1994 RW personal 8/6/94 8/6/94 R113756 Ctsc RW ctsc Ctsc cathepsin C Expressed ubiqutously. Similar in action to chymotrypsin, but more restricted in specificity. Attacks only peptide linkages at a specific distance from free alpha amino groups. 3.4.4.9 1994 RW personal 9/7/94 10/17/94 R113991 Cyb561 RW cyb561 Cyb561 cytochrome b561 CYB561 17q11-qter Mapped in human. Probable mouse homolog. A major transmembrane protein of catecholamice and neuropeptide secretory vesciles. 30 kDa cytochrome. McBride OW 1994 Genomics 21:662 U06715 (Hsa) 1994 RW personal 8/10/94 8/31/94 R113623 Cyp16a1 RW C-P-450-16-alpha cyp16a1, cp45016alpha Cyp016a001 testosterone 16-alpha-hydrolase 1 CA. Member of a gene family of male-specific testoserone 16-alpha-hydrolase genes. Title of paper by Wong G 1989 suggests in has been mapped. Wong G 1989 J Bio Chem 264:2920 M24262, M24267, M60267, M60268, M60269, M60279, M60271, M60272, M60273 9 exons. D 1989 RW personal 8/10/94 R111186 Cyp16a2 RW C-P-450-16-alpha cyp16a2, cp45016alpha Cyp016a002 testosterone 16-alpha-hydrolase 2 CB. Member of a gene family of male-specific testoserone 16-alpha-hydrolase genes. Title of paper by Wong G 1989 suggests in has been mapped. Wong G 1989 J Bio Chem 264:2920 M24263 D 1989 RW personal 8/10/94 R111187 Cyp16a3 RW C-P-450-16-alpha cyp16a3, cp45016alpha Cyp016a003 testosterone 16-alpha-hydrolase 3 CC. Member of a gene family of male-specific testoserone 16-alpha-hydrolase genes. Title of paper by Wong G 1989 suggests in has been mapped. Wong G 1989 J Bio Chem 264:2920 M24264 D 1989 RW personal 8/10/94 R111188 D0H5S39 RW d0h5s39, d5s39 d00h05s0039 DNA segment, human Chr 5, S39 Hom D5S39 5q11.2-q13.3 Mapped in human and cow. May have a mouse homolog. Chr 13 a good candidate. U20 1994 RW personal 8/10/94 8/18/94 R111743 Dagk RW dagk Dabk diacylglycerol kinase DAGK 12q13.1-q13.3 Converts diacylglycerol to phosphatidic acid. About 89 kDa isolform from pig brain. Hart TC 1994 Genomics 22:246 1994 RW personal 9/21/94 10/17/94 R114109 Dcmd RW dcmd Dcmd dominant cystoid macular degeneration DCMD 7p Degeneration of the macular portion of the retina. A human locus that may have a mouse homolog. Not allelic with the autosomal dominant retinitis pigmentosa locus adRP that is also on 7p of humans. Kremer H 1994 Hum Mol Genet 3:299 DCMD in human is distal to D7S526, probably between D7S516 and D7S493. 1994 RW personal 9/18/94 10/7/94 R114092 Delta RW delta Delta delta zinc finger transcription factor A zinc finger transcription factor that binds to downstream elements in serveral polymerase II promoters. Provisional non-standard symbol from primary source. Hariharan N 1991 PNAS 88:97999 L11064 mRNA sequence D 1991 RW personal 8/10/94 8/9/94 R111189 Dntt RW dntt Dntt Get name DNTT 10q23.1-q24.1 Human gene. May have a mouse homolog. CRI-JS8055 M22968 1994 RW personal 9/18/94 10/7/94 R114094 Dor1 RW dor1 Dor001 opioid receptor, delta Hom DOR1 1p34 By homology to other human 1p34 loci, the mouse gene might be expected to map to mouse Chr 4 (RW, Mar 94). Close homology with somatostatin receptor G protein-coupled receptors. Evans C 1992 Science 258:1952 & Kieffer B 1992 PNAS 89:12048 L07271, L06322, L11064 mRNA sequence. Cloned from NG108-15 cell expression library. 7 putative transmembrane domains. Human delta maps to 1p34. D syn 1992 RW personal 8/10/94 8/18/94 R111191 Dpcp1 RW dpcp1, dcp1 Dpcp001 dipeptidyl carboxypeptidase 1, angiotensin 1 converting enzyme. Hom DCP1 17q23 Mapped in human and rat. Mouse homolog probably on Chr 11. Symbol should be Dcp1. However, this will require changing symbols of dexamethasone induced cleft palate 1 and 2. 11 10 1994 RW personal, nomenclature 8/10/94 11/16/94 R111761 Dsc1 RW dsc1 Dsc001 desmocollin 1 DSC1 18 A human gene that may have a mouse homolog. King IA 1993 Genomics 18:185 D 1993 RW personal 8/10/94 3/24/94 R111524 Dsc2 RW dsc2 Dsc002 desmocollin 2 A human gene that may have a mouse homolog. 1994 8/10/94 3/24/94 R111525 Dsg2 RW dsg2 Dsg002 desmoglein 2 DSG2 18q Mapped in human and cow. Mouse homolog may map to Chr 18. Buxton RS 1994 Genomics 21:510 & Overhauser J 1993 Genomics 15:387 Z26317 (Hsa) 1994 RW personal 8/10/94 8/31/94 R113620 Dsp1 RW dmpl Dsp001 desmoplakin 1 Important component of the cytoplasmic surface of desmosomes. Interacts with cytokeratin filaments. Desmosome component. protein (membrane) 1993 RW personal 8/10/94 R111193 Dts RW dts Dts diphtheria toxin sensitivity Hom DTS 5q23 Mapped in human and hamster. Mouse homolog like to be on Chr 11 (RW Mar 94). 2q 1994 RW personal 8/10/94 8/18/94 R111744 Dyt1 RW dyt1, itd Dyt001 dytonia 1 DYT1 9q34-q34 Idiopathic torsion dystonia. May have a mouse homolog. Kramer PL 1994 Am J Hum Genet 55:468 2 In humans this disease locus is linked to ASS and ABL. Mouse homologue expected on proximal Chr 2. 1994 RW personal 9/18/94 10/7/94 R114090 E2-2 RW e22 E002-002 E2-2 helix-loop-helix protein E2-2 is a non-tissue specific E-type protein that forms heterodimers with numerous tissue-specific basic helix-loop-helix proteins. Zhuang Y 1994 Cell 79:875 1994 RW personal, nomenclature 12/17/94 12/17/94 R115269 E2A RW e2a, e12, e47 E002a E2A helix-loop-helix protein E2A is a non-tissue specific protein that forms heterodimers with numerous tissue-specific basic helix-loop-helix proteins. It is required in B cell development. E12 and E47 are splice variants from the E2A gene. Hu JS 1992 Mol Cell Biol 12:1031 & Zhuang Y 1994 Cell 79:875 & Bain G 1994 Cell 79:885 1992 RW personal 12/17/94 12/18/94 R115267 Eaac1 RW eaac1 Eaac001 high affinity glutamate transporter, sodium-dependent, EAAC1 EAAC1 A rat gene that probably has a mouse homolog. Expressed in brain. GLAST family member. Kanai Y 1992 Nature 360:467 1992 RW personal 11/29/94 11/29/94 R115234 Eaat3 RW eaat3 Eaat003 excitatory amino acid transporter 3 EAAT3 Kirschner MA 1994 Genomics 22:631 U03506 (Hsa) 1994 9/11/94 9/11/94 R114054 Ebvr RW ebvr Ebvr Epstein-Barr virus receptor Symbol is a temporal placeholder. May have been assigned a symbol already. Get proper symbol from GDB. M35684, M26004 (Hsa) 1994 RW personal 8/30/94 10/17/94 R113945 Ece1 RW ece1 Ece001 endothelin converting enzyme 1 A membrane bound protease that generates endothelin 1 from a larger precursor by cleavage at Trp-21 / Val-22. Ece1 is related to neutral endopeptidase 24.11 and the Kell blood group protein. Xu D 1994 Cell 78:473 Sequenced in cow 1994 RW personal 9/1/94 10/17/94 R113965 Edf RW edf Edf erythroid differentiation factor Many be the same as Nfe2. Symbol is placeholder only. M37482 (Rno), J03634 (Hsa) 1994 RW personal 8/30/94 10/17/94 R113946 Edh17b2 RW edh17b2, brca1 Edh017b002 17 beta-hydroxysteroid dehydrogenase type 1 gene 2 EDH17B2 17q12-q21 Catalyzes the conversion of estrone and estradiol. Expressed in placenta and ovary and breast. Possible association with familial breast cancer (BRCA1). Mapped in human. May have a mouse homolog. In human there are two major transcripts of 1.3 and 2.3 kb. Peltoketo H 1994 Genomics 23:250 11 Predicted to be linked to Krt1.14 on mouse Chr 11 at about 56 cM. 1994 RW personal 9/18/94 10/7/94 R114078 Edrp99 RW ERp99 edrp99, erp99 Edrp099 endoplasmic reticulum transmembrane protein 99 Mazzarella R 1987 J Bio Chem 262:8875 J03297 mRNA sequence. D 1987 RW personal 8/10/94 R111194 Egr3 RW egr3 Egr003 early growth response 3 EGR3 1994 8/10/94 7/3/94 R111936 Ehk1 RW ehk1 ehk001 EPH-related transmembrane tyrosine kinase 1 Member of a large family of receptor-like tyrosine kinases, many of which display specific patterns of expression in the developing and adult nervous system. This member has restricted expression to neurons in locus coeruleus and dopaminergic neurons in substantia nigra. Maisonpierre PC 1993 Oncogene 8:3277 & Davis S 1994 Science 266:816 1993 RW personal 1/22/95 1/22/95 R115283 Ehk2 RW ehk2 ehk002 EPH-related transmembrane tyrosine kinase 2 Member of a large family of receptor-like tyrosine kinases, many of which display specific patterns of expression in the developing and adult nervous system. This member has restricted expression to neurons in locus coeruleus and dopaminergic neurons in substantia nigra. Maisonpierre PC 1993 Oncogene 8:3277 & Davis S 1994 Science 266:816 1993 RW personal 1/22/95 1/22/95 R115284 Eks RW eks Eks enkephalinase Symbol is just a provisional placeholder by RW. Get GDB symbol. M15944 (Rno), J03779 (Hsa) 1994 RW personal 8/30/94 8/30/94 R113944 Elk RW elk elk EPH-related transmembrane tyrosine kinase Member of a large family of receptor-like tyrosine kinases, many of which display specific patterns of expression in the developing and adult nervous system. This member has restricted expression to neurons in locus coeruleus and dopaminergic neurons in substantia nigra. Lhotak V 1991 Mol Cell Biol 11:2496 & Davis S 1994 Science 266:816 1993 RW personal 1/22/95 1/22/95 R115285 Empb3-rs1 RW Empb3-rs1, Empb3-r1 empb3rs1, empb3r1 Empb003rs001 erythrocyte membrane protein, band 3, related sequence 1 Symbol is non-standard. The related protein should be matched to the corresponding related genomic sequence or locus. The symbol should therefore be changed to Empb3-rs1. Changed by RW, provisionally. Check with GBASE. Alpert 1988 JBC 263:17092 D 1988 RW personal, nomenclature 8/10/94 R111195 End1 RW End-1, mET end1, met End001 endothelin 1 A vasoactive intestinal contractor peptide. Dog sequence data. Symbol taken from GenBank with modification. Saida K 1989 J Bio Chem 264:14613 & Oureshi S 1994 Mouse Genome Conference 8:118 M26497 D 1989 old RW personal 8/10/94 11/9/94 R111196 End2 RW End-2 end2 End002 endothelin 2 Reserved by RW provisionally. Check with GBASE. Dog sequence data. Symbol taken from GenBank with modification. Get reference 1993 RW personal, nomenclature 8/10/94 11/7/94 R111197 Epim RW epim Epim epimorphin A mesenchymal protein essential for epithelial morphogenesis. Hirai Y 1992 Cell 69:471 D10475 mRNA sequence. D 1992 RW personal 8/10/94 R111198 Epit RW epit Epit epithelin Two products, epithelin 1 and 2 have opposing action on epithelial cell growth. Plowman G 1992 J Bio Chem 267:13073 X62321 mRNA sequence. D 1992 RW personal 8/10/94 R111199 Epoc1 RW Epoc-1 epoc1 Epoc001 epidermal POU domain 1 POU domain transcription factor gene expressed in epidermal basal cells and thymic stromal cells. Yukawa K 1993 Gene 000:000 L14677 mRNA sequence. D 1993 RW personal 8/10/94 R111200 Erba2l RW erba2l, erba21 Erba002l avian erythroblastic leukemia viral oncogene homolog 2-like ERBA2L 17q25 Mapped only in human. Possible mouse homolog, perhaps on Chr 11. 1994 RW personal 8/10/94 3/26/94 R111725 Eta RW eta End001r endothelin 1 receptor Hom ETA, PDK4? 4 Receptor of End1 suggested to be a candidate for polycystic kidney disease gene on human Chr 4. Mapped in human to Chr 4. Kinberling WJ 1993 Genomics 18:467 X57764 (Rno), M74921 (Hsa) 1994 RW personal 8/10/94 8/30/94 R111545 Etk1 RW etk1, hek Etk001 hek receptor tyrosine kinase ETK1 3p11.2 A human kinase expressed in some pre-B and thymic cell lines. Member of the EPH family of RTKs. Wicks IP 1994 Genomics 19:38 D 1993 RW personal 8/24/94 8/24/94 R113804 Etr101 RW pip92 etr101, pip92, egr Etr101 transcription factor ETR101 Symbol is just a temporary placeholder. Should probably be changed to Egr#. M59821, M62831 (Hsa) 1994 RW personal 9/10/94 10/17/94 R114006 Fecb RW fecb Fecb fecundity B FECB 4q A gene mapped only in sheep. In the Booroola Merino strain of sheep an allele in this locus increases fecundity. Montgomery GW 1994 Genomics 22:148 6q 1994 RW personal 9/20/94 10/17/94 R114103 Fglp RW fblp Fglp fibrinogen like protein A cytotoxic T-lymphocyte specific gene that shows a strong homology to fibrinogen beta and gamma chains. Koyama T 1987 PNAS 84:1609 M15761, M16238 Two exons sequenced. D 1987 RW personal 8/10/94 R111203 Fic RW fic Fic cytokine fic Growth factor activated gene. Fic is a biologically active C-C type cytokine. Temporary symbol. Heinrich J 1992 Mol Cell Biol 13:2020 :04694 mRNA sequence, complete cds. D 1992 RW personal 8/10/94 R111204 Fkbp12 RW fkbp12, fk506bp Fkbp012 FK506 binding protein FKBP12 A proline isomerase and the cytosolic receptor for the immunosuppressant drug FK506. In human is is a ubiquitously expressed 12 kDa protein. A set of four Fkbp12 molecules associate with the ryanodine receptor. Increases the conductance of the ryanodine receptor calcium releasing channel in muscle. Brillantes AMB 1994 Cell 77:513 1994 RW personal 8/23/94 8/23/94 R113794 Fln1 RW fln1, abp280 Fln001 filamin 1 / actin-binding protein 280 FLN1 Filamin is a ubiquitous homodimeric protein that plays a key role in mechanochemical activity of cells. Binds with actin and membrane glycoproteins. Patrosso MC 1994 Genomics 21:71 X X53416 (Hsa) In human a 47 exon gene spanning 26 kb. 1994 RW personal 10/29/94 10/29/94 R114374 Fmb RW fmb Fmb fimbrin Actin cross-linking protein. 1993 RW personal 8/10/94 R111205 Fnta RW fnta Fnta farnesyltransferase, alpha FNTA 8p22-q11 Andres DA 1993 Genomics 18:105 (FNTA) L10413 (Hsa) enzyme (transferase); human (disease model); eye (unclassified) 1993 RW personal 8/10/94 R111206 Fntal1 RW fntal1 Fntal001 farnesyltransferase, alpha like 1 FNTAL1 11q13.4-q14.1 Andres DA 1993 Genomics 18:105 1993 RW personal 8/10/94 R111207 Fntal2 RW fntal2 Fntal002 farnesyltransferase, alpha like 2 FNTAL2 13 Andres DA 1993 Genomics 18:105 1993 RW personal 8/10/94 R111208 Fntb RW fntb Fntb farnesyltransferase, beta FNTB 14q23-q24 Beta subunit of the heterodimer CAAX farnesyltransferase, a prenyltransferase. This 100 kDa enzyme attaches a farnesyl group to COOH end of variety of cellular proteins to provide them with a means to insert in membrane. Andres DA 1993 Genomics 18:105 (FNTB) L10414 (Hsa) enzyme (transferase); human (disease model); eye (unclassified) 1993 RW personal 8/10/94 R111209 Fntbl2 RW fntbl1 Fntbl001 farnesyltransferase, beta like 1 FNTBL1 9 Andres DA 1993 Genomics 18:105 1993 RW personal 8/10/94 R111210 Fra1 RW fra1 Fra001 fos related antigen 1 Hom FRA1 11q13 A human gene. May have mouse homolog. Sinke RJ 1993 Genomics 18:165 1994 RW personal 8/10/94 8/18/94 R111546 Frkhr1 RW frkhr1 Frkhr001 fork head related protein 1 Fork head related gene expressed during gastrulation and axial pattern formation. Sasaki H 1993 Development 118:47 L10406 mRNA sequence D 1993 RW personal 8/10/94 7/16/94 R111211 Frkhr2 RW frkhr2 Frkhr002 fork head related protein 2 Fork head related gene expressed during gastrulation and axial pattern formation. Sasaki H 1993 Development 118:47 L10407 mRNA sequence D 1993 RW personal 8/10/94 7/16/94 R111212 Frkhr3 RW frkhr3 Frkhr003 fork head related protein 3 Fork head related gene expressed during gastrulation and axial pattern formation. Sasaki H 1993 Development 118:47 L10408 mRNA sequence D 1993 RW personal 8/10/94 7/16/94 R111213 Fshd RW fshd Fshd syn facioscapulohumeral muscular dystrophy FSHD 4q35-q35 A human mutation on 4q35. Predicted location of mouse gene on Chr 8, linked perhaps to Kal3. Weiffenbach B 1994 Genomics 19:532 8 1994 RW personal 10/7/94 11/13/94 R114182 Fst-rs1 RW TSC-36 fstrs1, tsc36 Fstrs001 follistatin related sequence 1, transforming growth factor beta inducible Shibanuma M 1992 Eur J Biochem 000:000 M91380 mRNA sequence. D 1992 RW personal 8/10/94 R111214 G10p1 RW g10p1 G010p001 Get name G10P1 10q23-q24 CRI-JS8078 X06559 1994 RW personal 9/18/94 9/18/94 R114095 G10p2 RW g10p2 G010p002 Get name G10P2 10q23.1-q23.1 CRI-JS8079 X07557 1994 RW personal 9/18/94 9/18/94 R114096 Gadd45 RW Gadd45 Gadd045 growth arrest and DNA damage inducible 45 GADD45 A ubiquitously expressed DNA repair enhancing protein that binds to cyclin dependent kinases and proliferating cell nuclear antigen. Activated by p53, GADD45 interacts with PCNA. Prevents the entry of dividing cells into the DNA synthesis phase. GADD45 links the p53-dependent G1 arrest with DNA repair mechanisms. Actually a 19 kDa protein. Smith ML 1994 Science 266:1376 1994 RW personal 12/13/94 12/13/94 R115256 Gagp12 RW MMGAG gagp12 Gagp012 p12 gag gene homolog Casabianca A 1994 Biochem Int 32:691 X72930 X72930: 250 bp genomic sequence. 1994 RW personal 9/1/94 10/7/94 R113973 Galns RW galns Galns N-acetylgalactosamine 6-sulfatase GALNS 16q24.3 A lysosomal exohydrolase required for the breakdown of glycosaminoglycans, keratin sulfate, and chrondroitin sulfate. Mutations or deficiency of this enzyme leads to Morquio A syndorme, characterized by growth retardation, skeletal problems, loose joints. Morris CP 1994 Genomics 22:652 8 3.1.6.4 U06078-U06088 (Hsa) Human gene is 14 exons spanning about 40 kb. 1994 RW personal 9/11/94 9/18/94 R114058 Ganc RW ganc Ganc glucosidase, alpha, neutral C GANC 15 GANC maps in rat to Chr 3, Chr 15 in human. Probably maps to mouse Chr 2 or 9 (RW Mar 94). 3 1994 RW personal 8/10/94 3/27/94 R111757 Gar1 RW Gar-1 gar1 Gar001 gastric receptor 1 Also called gastrin receptor. Locus symbol provisionally reserved by RW based on dog sequence data. Check with GBASE. Symbol modified from GenBank. Get reference protein (receptor); viscera (stomach and intestine) 1993 RW personal 8/10/94 R111215 Gas3 RW gas3 Gas003 growth arrest specific 3 Manfioletti G 1990 Mol Cell Biol 10:2924 M32240 D 1990 RW personal 8/10/94 R111216 Gdh RW gdh Gdh glucose dehydrogenase Hom GDH 1p36 Mapped in human, cow, and rat. Mouse homolog likely to be on Chr 4. May be the same as Gpd1. 5 RW personal 8/10/94 8/18/94 R111705 Ge1 RW MUSHTHTRFB ge1 Ge001 helix-loop-helix transcription factor GE1 Helix-loop-helix transcription factor sequence. *Title* ME1 and GE1: Helix-loop-helix transcription factors expressed in at high levels in developing nervous system and in morphogenetically active regions . Neuman T 1992 Devel Bio ???:??? M97636 D 1992 RW personal 8/10/94 R111218 Gfilzl RW TSC-22 gfilzl, tsc22 Glilzl growth factor induced, leucine zipper like Putative leucine zipper gene induced by transforming growth factor beta and other growth factors. Shibanuma M 1992 J Bio Chem 267:10219 X62940 mRNA sequence. D 1992 RW personal 8/10/94 R111220 Gfrp2 RW gfrp2 Gfrp002 growth factor response protein 2 A growth factor inducible protein. A nuclear protein with a novel cysteine/histidine repetitive sequence. DuBois R 1990 J Biol Chem 265:19185 M58691 D 1990 RW personal 8/10/94 R111219 Glast1 RW glast1 Glast001 sodium-dependent glutamate/aspartate transporter GLAST1 A rat gene that probably has a mouse homolog. This family of genes contains at least four members, Glt1, Glast1, Eaa1, and Asct1. Expressed in brain. Storck T 1992 PNAS 89:10955 1992 RW personal 11/29/94 11/29/94 R115232 Glt1 RW glt1 Glt001 L-glutamate transporter 1, sodium-dependent GLT1 A rat gene that probably has a mouse homolog. Expressed in brain. Pines G Nature 360:464 1992 RW personal 11/29/94 11/29/94 R115233 Glyif RW glyif Glyif glycosylation inhibiting factor mRNA, complete cds. Mikayama T 1993 PNAS 00:000 L10613 D 1993 RW personal 8/10/94 R111221 Gm2 RW gm2 Gm002 granulocyte macrophage antigen 2 Bellachioma G 1993 Biochem J 000:000 L19526 D 1993 RW personal 8/10/94 R111222 Gp96 RW gp96 Gp096 glycoprotein 96 Sequence data in mouse and human. J03297, X15187 (Hsa) 1994 RW personal 8/31/94 8/31/94 R113949 Gpa1a RW MUSAGP, Agp-1, Agp, Ebp, Cga? gpa1a, agp1, agp, ebp, cga Gpa001a glycoprotein, alpha-1-acid A transcription factor, AGP/EBP, that belongs to members of the C/EBP family. Reserved by RW provisional. Check with GBASE. May be related or same as Cga. Chang C 1990 Mol Cell Biol 10:6642 & Cooper R 1987 Biochem 26:5244 & Prowse K 1990 J Bio Chem 265:10201 M17376, M61007, M34648 alpha-1-acid glycoprotein I (AGP-1) gene, complete cds. *Title* Nucleotide sequence of the mouse alpha-1-acid glycoprotein gene 1 D 1990 RW personal 8/10/94 R111223 Gpr1 RW gpr1 Gpr001 G protein couple receptor 1, hippocampus GPR1 15q21.6 A human G protein coupled receptor that may have a mouse homolog. Expressed most abundantly in hippocampus. Marchese A 1994 Genomics 23:609 U13666 (Hsa) 1994 RW personal 10/29/94 10/29/94 R114376 Gpr2 RW gpr2 Gpr002 G protein couple receptor 2 GPR2 17q21.1-q21.3 A human G protein coupled receptor that may have a mouse homolog. Resembles interleukin 8 receptor. Marchese A 1994 Genomics 23:609 U13667 (Hsa) 1994 RW personal 10/29/94 10/29/94 R114377 Gpr3 RW gpr3 Gpr003 G protein couple receptor 3 GPR3 1p35-p36.1 A human G protein coupled receptor that may have a mouse homolog. Has a rat homolog which has been cloned. Marchese A 1994 Genomics 23:609 U13668 (Hsa) 1994 RW personal 10/29/94 10/29/94 R114378 Gs1 RW gs1 Gs001 GS1 gene Hom GS1 Xp22.3 A human gene of unknown function located near STS and KAL1. Yen PH 1992 Hum Mol Genet 1:47 Encodes a 214 aa protein. 7 exons in human, spanning over 26 kb with a CpG islated in the first intron. 1994 RW personal, nomenclature 8/18/94 8/18/94 R113781 Gs2 RW gs2, dxs1283e Gs002 GS2 gene Hom GS2, DXS1283E Xp22.3 A human gene of unknown function located near STS and KAL1. Produces a 2.3 kb transcript expressed in placenta and fibroblasts. Map have a mouse homolog. Deletion of gene does not appear to be detrimental. There are remnants of GS2 on the human Y chromosome. Lee WC 1994 Genomics 22:372 U03886 (Hsa), U08887 (Hsa), U08888 (Hsa), U08889 (Hsa), U08890 (Hsa), H088891 (Hsa), U088892 (Hsa), U088893 (Hsa) Encodes a 214 aa protein. 7 exons in human, spanning over 26 kb with a CpG islated in the first intron. 1994 RW personal, nomenclature 8/18/94 10/7/94 R113780 Gstap RW gstap Gstap galactosyltransferase associated protein Symbol is just a temporal placeholder. Get proper symbol from GDB. M58633, M37712 (Hsa) 1994 RW personal 8/31/94 8/31/94 R113948 Gstm1 RW gstm1 gstm001 glutathione S-transferase M1 Hom GSTM1 1p31 Mapped in human and rat. May have mouse homolog on Chr 8. 2 RW personal 8/10/94 8/18/94 R111706 Gtf2e1 RW gtf2e1, tfiie, tf2e Gtf002e001 transcription factor IIE, 56 kDa subunit 1 GTF2E1 3q13-q21 The smaller subunit of the general transcription factor of class II promoter sites. TFIIE is a heterotetramer made up of GTF2E1 and GTF2E2. Purrello M 1994 Genomics 23:253 16 Mouse homologue may be linked with Drd3 on Chr 16. 1994 RW personal 9/18/94 9/18/94 R114081 Gtf2e2 RW gtf2e2, tfiie, tf2e Gtf002e002 transcription factor IIE, 34 kDa subunit 2 GTF2E2 8p12-p12 The smaller subunit of the general transcription factor of class II promoter sites. TFIIE is a heterotetramer made up of GTF2E1 and GTF2E2. Purrello M 1994 Genomics 23:253 8 Mouse homologue predicted to be on Chr 8 linked to Fgfr1 and Polb. 1994 RW personal 9/18/94 9/18/94 R114080 Gubp RW gubp Gubbp guanylate binding protein Sequence data in both mouse and human. M63961, M55542 (Hsa) 1994 RW personal 8/31/94 8/31/94 R113950 Guc2d RW guc2d, retgc Guc002d guanylate cyclase 2D, retinal Hom GUC2D 17p13.1 Photoreceptor guanylate cyclase. Probably has a mouse homolog. Oliveira L 1994 Genomics 22:478 1994 8/18/94 10/7/94 R113785 Guk2 RW guk2 guk002 guanylate kinase 2 Hom GUK2 1q Mapped in human to 1q.May have mouse homolog. 1994 RW personal 8/10/94 8/18/94 R111710 Gzc RW gzc Gzc granzyme C, serine protease like protein A serine protease. Symbol is just a placeholder. Use GDB nomenclature, if available. M18459, M17016 (Hsa) D P enzyme (serine protease) 1994 RW personal 9/10/94 1/17/95 R114000 Hba-ps30.5 RW Hba-ps3.5 hbaps305 Hbaps0030.5 mouse alpha-globin, psi alpha 30.5 pseudogene Not in GBASE. Taken from GenBank data. Vanin E 1980 Nature 286:222 J00412 a mouse alpha-globin-related pseudogene lacking intervening sequences D 1980 RW personal 8/10/94 R111225 Hbatf1 RW Agtf-cp2, MUSAGTFCP Hbatf1 Hbatf001 alpha globin transcription factor CP2 Reserved provisionally by RW based on GenBank data. Symbol modified version from GenBank. Get reference M84809, M76987 Alpha-globin transcription factor CP2 mRNA sequence. *Title* Molecular cloning of the alpha-globin transcription factor CP2 D 1993 RW personal 8/10/94 R111226 Hbb-y2 RW MUSHBBY2E, MUSHBY2 hbby2 Hbby002 hemoglobin, beta, epsilon Y2 Not in GBASE. Reserved provisionally by RW based on GenBank sequences and associated papers. Note, however, that this locus may be equivalent to one the formal Hbb loci, perhaps Hbb-y. Vanin E 1981 Gene 16:141 & Hansen J 1982 J Bio Chem 257:1048 J00419, J00420, M26897 embryonic Y2 beta-globin gene, complete cds. *Title* The sequence of a mouse embryonic beta-globin gene D 1981 RW personal 8/10/94 R111227 Hbb-y3 RW MUSHBBE hbby3 Hbby003 hemoglobin, beta, epsilon Y3 Not in GBASE. Reserved provisionally by RW based on GenBank sequences and associated papers. Note, however, that this locus may be equivalent to one the formal Hbb loci, perhaps Hbb-y. Jahn C 1980 Cell 21:159 & Holdener-Kenny B 1986 PNAS 83:4374 J00414, J00415 another mouse foetal beta-globin gene. One sequence from mRNA D 1980 RW personal 8/10/94 R111228 Hbp44 RW A2MRAP hbp44, a2mrap Hbp044 heparin binding protein, 44 kDa This is apparently the 40 kDa A2MR associated protein. In rat it is known as the autoimmune Heymann nephritis antigen, and is associated in rat kidney with the 300 kDa glycoprotein. Function is unknown (Nov 94). Furukawa T 1990 J Biochem 108:297 1990 11/30/94 11/30/94 R115237 Heb-hlh RW heb, hebhlh Hebhlh HEB helix-loop-helix protein HEB is a non-tissue specific E-type protein that forms heterodimers with numerous tissue-specific basic helix-loop-helix proteins. Zhuang Y 1994 Cell 79:875 1994 RW personal, nomenclature 12/17/94 12/17/94 R115268 Hen1 RW MUSHEN1A hen1 Hen001 helix-loop-helix protein 1 HEN1 Provisionally reserved by RW based on GenBank sequence data. Not in GBASE. Brown L 1992 PNAS 89:8492 M97506 helix-loop-helix protein (Hen1) gene, complete cds. *Title* HEN1 and HEN2: a subgroup of basic helix-loop-helix genes that are coexpressed in a human neuroblastoma D protein (transcription or translation factor, helix-loop-helix) 1992 RW personal 8/10/94 R111229 Hist2az RW hist2az, h2az Hist002az histone 2 A.Z gene H2AZ 4q24 A replication independent histone protein. In Drosophila this protein is essential for development. Not yet mapped in mouse. Popsecu reference is to human gene. Popescu N 1994 Genomics 20:333 1994 RW personal 8/10/94 8/1/94 R113638 Hlh-Alf1 RW Alf1 hlhalf1 Hlhalf001 helix-loop-helix protein, ALF1 Helix-loop-helix transcriptional activator proteins binding to the E-box motif of the Akv murine leukemia virus enhancer. Not listed in July 1993 GBASE. Reserved provisionally by RW based on GenBank data. Check with GBASE. Nielsen A 1992 Mol Cell Biol 12:3449 X64840 ALF1 mRNA *Title* Murine helix-loop-helix transcriptional activator proteins binding to the E-box motif of the Akv murine leukemia virus enhancer identified by cDNA cloning D DNA (transcription) 1992 RW personal 8/10/94 R111230 Hlh-Id RW Hlh-Id, hlhid HlhId helix-loop-helix protein, Id related Reserved provisionally by RW based on GenBank data. Check with GBASE. Christy B 1991 PNAS 88:1815 M60523, M60524 helix-loop-helix protein (Id related) mRNA, complete cds. *Title* An Id-related helix-loop-helix protein encoded by a growth factor-inducible gene D 1991 RW personal 8/10/94 R111231 Hmox2 RW hmox2, ho2 Hmox002 heme oxygenase 2 HMOX2 16p13.3 Decycling. The constitutive heme oxygenase. It is the rate limiting enzyme in the heme degradative pathway. Products are biliverdin and carbon monoxide. Important role in protection against oxidative stress. Kutty RK 1994 Genomics 20:513 19 (HEOX) 1.14.99.3 1994 RW personal 9/10/94 9/10/94 R114022 Hnrcp RW hnrcp, hnrnpcp hnrcp heavy nuclear ribosome nucleoprotein core protein Symbol is just temporary placeholder. Get proper symbol from GDB. Sequence data in rat and human. Baughman 1991 Mol Endocrinol 5:637 M12156 (Rno), X06747 (Hsa) protein (glycoprotein) 1991 RW personal 8/31/94 8/31/94 R113952 Hox10 RW Hox10 Hox010 homeobox 10 HOX10 14q24.3-q24.3 An orphan homeobox gene in human. May have a mouse homolog. 1994 RW personal, nomenclature 9/12/94 10/7/94 R114065 Hoxk RW Hox11 hoxk, hox11 Hox011 homeobox K Hom HOX11 10q24-q24 Also known as Hox11. Orphan homeobox encoding DNA binding nuclear transcription factor. Nomenclature changed by RW to Hoxk (11th letter) to conform with the mouse nomenclature. Confirm that this locus is the mouse homolog of human HOX11. Dear T 1993 PNAS 90:4431 CRI-JS8082 L21164, L21165, L21166, L21167, L21168, L21169, L08616, L08617, M33603 (Hsa) D Prediction location on Chr 19 if in fact this is the homologue of human 10q24 HOX11 locus. 1993 RW personal, nomenclature 8/10/94 10/7/94 R111232 Hras1-ps2 RW hras1ps2, hrasp hras001ps001 Harvey rat sarcoma viral oncogene homolog 1, pseudogene 1 HRASP Xpter-q26 Mapped in human, cat, and rat to Chr X. Mouse homolog may map to Chr X. X X X 1994 RW personal 8/10/94 4/3/94 R111764 Hsp70-4 RW hsp704, hspa6, hspa7 Hsp070-004 heat shock protein, 70 kDa 4 HSPA6 or HSPA7 A cow heat shock protein that may have a mouse homolog. The human homologue is either HSPA6 or HSPA7. Gallagher DS 1993 Mamm Genome 4:388 3q13 B D protein (heat shock) 1994 RW personal 8/23/94 10/7/94 R113795 Htlf RW htlf htlf T cell leukemia virus factor HTLF 17q25 A human gene and a fork head gene family member. No data on mouse homolog, if any. Mouse symbol is just a placeholder. Li J 1992 Genomics 13:665 1994 human 8/10/94 10/17/94 R113372 Htr1dp1 RW htr1dp1 htr001dp001 5 hyroxytryptamine receptor 1D pseudogene 1 HTR1DP1 12 A human gene that may not have a mouse homolog. Nguyen T 1993 Gene 124:295 1994 RW personal 9/11/94 10/7/94 R114056 Hymr RW hymr Hymr hyaluronan-mediated motility receptor A hyaluronic acid receptor that mediate tumor cell motility. Hardwick C 1992 J Cell Biol 117:1343 X64550 2915 nt mRNA sequence from BALB/c fibroblasts. 477 aa conceptual translation. D 1992 RW personal 8/10/94 R111233 Ice RW ice Ice interleukin-1 beta, converting enzyme A cysteine protease that activates interleukin-1 beta, an important mediator of inflammation. Homology to C. elegans ced-3 gene. May promote apoptosis of neurons in vivo. Ice activity may be neutralized by Bcl2. Yuan J 1993 Cell 75:641 & Gagliardini V 1994 Science 263:826 Cloned by Immunex Corp and Merck Res Lab. 28% sequence homology with ced-3 of C. elegans. D 1993 RW personal 8/10/94 R111234 Idb1 RW Id-1 idb1, id1 Idb001 inhibitor of DNA binding 1 Helix-loop-helix DNA binding protein regulator (Id) mRNA, 3' end. This protein, referred to as "Id" is a negative regulator of helix-loop-helix DNA binding proteins. Check whether this is the ID protein 1 that maps to Chr 2. Benezra R 1990 Cell 61:49 M31885 D 1990 RW personal 8/10/94 10/26/94 R111235 If RW 'if' If human complement factor I Hom IF 4q24-q25 An important serine protease and plasma glycoprotein with a molecular weight of 88 kDa. Its structure is similar to that of trypsin. Requires cofactors such as CD35 and CD46. Mapped in human, cow, and sheep. Threadgill DW 1990 Nucleic Acids Res 18:6935 & Vyse TJ 1994 Genomics 24:90 Y 6 3 126F6, 199D1, 108A11, 253G10 12 exons in human. A mouse homolog might map to Chr 3. In human this locus lies between the epidermal growth factor gene and inteleukin 2. 1990 RW personal, nomenclature. 8/10/94 11/30/94 R111735 Ifa13 RW ifa13, ifna13 ifa013 interferon alpha, subtype 13 IFNA13 9p22-p13 The type I IFNA13 is a human gene that may have a mouse homolog. Diaz MO 1994 Genomics 22:540 X00803 (Hsa), X00804 (Hsa) 1994 RW personal 9/11/94 10/7/94 R114034 Ifa14 RW ifa14, ifna14 ifa014 interferon alpha, subtype 14 IFNA14 9p22-p13 The type I IFNA14 is a human gene that may have a mouse homolog. Diaz MO 1994 Genomics 22:540 J00214 (Hsa), J00215 (Hsa), X02959 (Hsa), V00533 (Hsa) 1994 RW personal 9/11/94 10/7/94 R114035 Ifa16 RW ifa16, ifna16 ifa016 interferon alpha, subtype 16 IFNA16 9p22-p13 The type I IFNA16 is a human gene that may have a mouse homolog. Diaz MO 1994 Genomics 22:540 X02957 (Hsa), M28585 (Hsa), K02055 (Hsa), X00140 (Hsa) 1994 RW personal 9/11/94 10/7/94 R114036 Ifa17 RW ifa17, ifna17 ifa017 interferon alpha, subtype 17 IFNA17 9p22-p13 The type I IFNA17 is a human gene that may have a mouse homolog. Diaz MO 1994 Genomics 22:540 J00216 (Hsa), M11026 (Hsa), V00532 (Hsa), M38289 (Hsa) 1994 RW personal 9/11/94 10/7/94 R114037 Ifa21 RW ifa21, ifna21 ifa021 interferon alpha, subtype 21 IFNA21 9p22-p13 The type I IFNA21 is a human gene that may have a mouse homolog. Diaz MO 1994 Genomics 22:540 J00212 (Hsa), M12350 (Hsa), M28586 (Hsa), X00145 (Hsa) 1994 RW personal 9/11/94 10/7/94 R114038 Ifap22 RW ifap22, ifnap22 ifap022 interferon alpha, subtype pseudogene 22 IFNAP22 9p22-p13 IFNAP22 is a human psuedogene that is part of the IFNA family. Probably does not have a mouse homolog. Diaz MO 1994 Genomics 22:540 J00212 (Hsa), M12350 (Hsa), M28586 (Hsa), X00145 (Hsa) 1994 RW personal 9/11/94 10/7/94 R114039 Ifno RW ifno Ifo interferon, omega Provisionally reserved by RW based on dog and bovidae sequence data. Check with GBASE. Iannuzzi L 1993 Cytogenet Cell Genet 62:224 8q15, 2p15, 8q15 1993 RW personal 8/10/94 R111237 Ifnp11 RW ifnp11 ifnp011 interferon, pseudogene 11 IFNP11 9p22-p21 IFNP11 is a human pseudogene that is part of the IFN cluster on HSA Chr 9. May not have a mouse homolog. Diaz MO 1994 Genomics 22:540 1994 RW personal 9/11/94 10/7/94 R114048 Ifnp12 RW ifnp12 ifnp012 interferon, pseudogene 12 IFNP12 9p22-p21 IFNP12 is a human pseudogene that is part of the IFN cluster on HSA Chr 9. May not have a mouse homolog. Diaz MO 1994 Genomics 22:540 1994 RW personal 9/11/94 10/7/94 R114049 Ifnp20 RW ifnp20 ifnp020 interferon, pseudogene 20 IFNP20 9p22-p21 IFNP20 is a human pseudogene that is part of the IFN cluster on HSA Chr 9. May not have a mouse homolog. Diaz MO 1994 Genomics 22:540 1994 RW personal 9/11/94 10/7/94 R114050 Ifnp23 RW ifnp23 ifnp023 interferon, pseudogene 23 IFNP23 9p22-p21 IFNP23 is a human pseudogene that is part of the IFN cluster on HSA Chr 9. May not have a mouse homolog. Diaz MO 1994 Genomics 22:540 1994 RW personal 9/11/94 10/7/94 R114051 Ifnt RW ifnt Ifnt interferon, trophoblast Mapped in cow, sheep, and goat. Not in GBASE. Iannuzzi L 1993 Cytogenet Cell Genet 62:224 8q15, 2p15, 8q15 1993 RW personal 8/10/94 R111236 Ifnw1 RW ifnw1 ifnw001 interferon omega, subtype 1 IFNW1 9p22-p13 IFNW1 is a human gene that is part of the IFN cluster on HSA Chr 9. May not have a mouse homolog. Diaz MO 1994 Genomics 22:540 M11003 (Hsa), X02669 (Hsa), X58822 (Hsa) 1994 RW personal 9/11/94 10/7/94 R114041 Ifnwp15 RW ifnwp15 ifnwp015 interferon omega, pseudogene 15 IFNWP15 9p22-p21 IFNWP15 is a human pseudogene that is part of the IFN cluster on HSA Chr 9. May not have a mouse homolog. Diaz MO 1994 Genomics 22:540 K03013 (Hsa) 1994 RW personal 9/11/94 10/7/94 R114045 Ifnwp18 RW ifnwp18 ifnwp018 interferon omega, pseudogene 18 IFNWP18 9p22-p21 IFNWP18 is a human pseudogene that is part of the IFN cluster on HSA Chr 9. May not have a mouse homolog. Diaz MO 1994 Genomics 22:540 J00217 (Hsa) 1994 RW personal 9/11/94 10/7/94 R114046 Ifnwp19 RW ifnwp19 ifnwp019 interferon omega, pseudogene 19 IFNWP19 9p22-p21 IFNWP19 is a human pseudogene that is part of the IFN cluster on HSA Chr 9. Most proximal member of the IFN cluster. May not have a mouse homolog. Diaz MO 1994 Genomics 22:540 1994 RW personal 9/11/94 10/7/94 R114047 Ifnwp2 RW ifnwp2 ifnwp002 interferon omega, pseudogene 2 IFNWP2 9p22-p21 IFNWP2 is a human pseudogene that is part of the IFN cluster on HSA Chr 9. May not have a mouse homolog. Diaz MO 1994 Genomics 22:540 1994 RW personal 9/11/94 10/7/94 R114042 Ifnwp5 RW ifnwp5 ifnwp005 interferon omega, pseudogene 5 IFNWP5 9p22-p21 IFNWP5 is a human pseudogene that is part of the IFN cluster on HSA Chr 9. May not have a mouse homolog. Diaz MO 1994 Genomics 22:540 1994 RW personal 9/11/94 10/7/94 R114043 Ifnwp9 RW ifnwp9 ifnwp009 interferon omega, pseudogene 9 IFNWP9 9p22-p21 IFNWP9 is a human pseudogene that is part of the IFN cluster on HSA Chr 9. May not have a mouse homolog. Diaz MO 1994 Genomics 22:540 1994 RW personal 9/11/94 10/7/94 R114044 Igebp RW igebp Igebp IgE binding protein / episolon binding protein Sequence data in rat and human. Symbol is just a temporary placeholder. J02962, M57710 (Hsa) 1994 RW personal 8/31/94 8/31/94 R113953 Ighml RW ighml Ighml immunoglobulin heavy chain mu like Provisionally reserved by RW based on cow data. May not exist in mouse. Check with GBASE. Ponce de Leon 1991 11q22-23, 3p23, 11q23 (IGHML) 1993 RW personal 8/10/94 R111238 Ikba RW ikba, mad3 Ikba I kappa B protein A IKBA Human gene that probably have a mouse homolog. Member of a family of transcription regulators. Similar to Bcl3 in mouse, and NFKB2 in human and the Drosophila cactus gene. Haskill S 1992 Cell 65:1282 1991 RW personal 11/30/94 11/30/94 R115247 Il3r RW Il-3r il3rrs Il003r interleukin 3 receptor Gorman D 1990 PNAS 87:5459 M34397 interleukin 3 receptor-like protein (AIC2B) mRNA, complete cds. *Title* Cloning and expression of a novel interleukin 3 receptor-like gene: Identification of another member of the cytokine receptor gene fami D 1990 RW personal 8/10/94 R111240 Il8 RW Il-8 il8 Il008 interleukin 8 Hom IL8 4q13-q21 A pro-inflammatory cytokine induces neutrophil accumulation and activation. Functional as a monomer. Mapped in cat and human. May have mouse homolog. Chr 5 is a good candidate. Rajarathnam K 1994 Science 264:90 Y B1 1993 RW personal 8/10/94 8/18/94 R111241 Inara RW inara, rig Inara insulinoma rig analog Symbol is just a temporary placeholder. Sequence data in rat and human. M19393 (Rno), J02984 (Hsa) 1994 RW personal 8/31/94 8/31/94 R113954 Intf RW intf Intf intrinsic factor Symbol is just a temporary placeholder. Get proper symbol from GDB. Sequence data in rat and human. J03577, M63154 (Hsa) 1994 RW personal 8/31/94 8/31/94 R113955 Ivd RW ivd Ivd isovaleryl coenzyme A dehydrogenase Hom IVD 15q14-q15 Mapped in rat to Chr 3. and human to 15q14-q15. Possible mouse homolog, perhaps on Chr 2 (RW Mar 94). Get reference 3 (IVD) J05031 (Rno), M34192 (Hsa) 1993 RW personal 8/10/94 8/31/94 R111242 Kactap RW kactap Kactap 3-keto acyl coenzyme A thiolase A, peroxisomal Locus mapped in rat to Chr 8. Also referred to as 3-oxoacyl-CoA thiolase. Get reference 8 (KACTAP) J02749 (Rno), X12966 (Hsa) 1993 RW personal 8/10/94 8/28/94 R111244 Kal5 RW mGK-5 kal5, mgk5 Kal005 kallikrein 5, glandular Drinkwater C 1987 Nucleic Acids Res 15:10052 Y00500, J00389 D 1982 RW personal 8/10/94 R111245 Kal6 RW mGK-6 kal6, mgk6 Kal005 kallikrein 6, tissue A tissue kallikrein gene, mGK-6, that is expressed in a mouse neuroendocrine cell line. Nomenclature is highly provisional. Tada M 1994 Unpublished D10464, D01066 863 bp mRNA sequence D 1982 RW personal 8/9/94 8/9/94 R113767 Kex2-lpt RW Kex2lpt Kex002lpt Kex2-like endoprotease Sequence data in mouse and human. This symbol is just a temporary placeholder. Get GDB symbol. M55669, J05252 (Hsa) 1994 RW personal 8/31/94 8/31/94 R113956 Kgf RW kgf Kgf keratinocyte growth factor Induced in fibroblasts below and around wounds. KGF is a highly potent mitogen for keratinocytes. Werner S 1994 Science 266:819 1994 RW personal 1/22/95 1/22/95 R115286 Kng RW kng Kng kininogen Hom KNG 3q26-qter Mapped in human and rat. Mouse homolog expected to map to Chr 3, 9, or 16. 11 1994 RW personal 8/10/94 8/18/94 R111729 Kras1p RW kras1p Kras001p Kirsten rat sarcoma oncogene 1, processed pseudogene Hom KRAS1P 6p12-p11 v-Ki-ras1 oncogene. Mapped in human and cat. May have a mouse homolog. Y B2 1994 RW personal 8/10/94 8/18/94 R111747 Krtap1 RW krtap1 Krtap001 keratin associate protein 1 family, high sulfur Mapped in sheep as the KRTAP1 gene complex. Tight linkage in sheep with Gh and Hox2. Parsons YM 1994 Genomics 20:500 11q25 1994 RW personal 9/10/94 9/10/94 R114016 Krtap6 RW krtap6 Krtap006 keratin associate protein 6 family, high glycine-tyrosine Mapped in sheep as the KRTAP6 gene. Parsons YM 1994 Genomics 20:500 1 1994 RW personal 9/10/94 9/10/94 R114017 Krtap8 RW krtap8 Krtap008 keratin associate protein 8 family, high glycine-tyrosine Mapped in sheep as the KRTAP8 gene. Parsons YM 1994 Genomics 20:500 1 1994 RW personal 9/10/94 9/10/94 R114018 Lama3 RW lama3 Lama003 laminin A, variant 3, kalinin LAMA3 18q A human gene. A variant laminin A chain related to merosin (laminin A2). LAMA4 was once referred to as LAMA3. However, LAMA3 now used to refer to the kalinin/nicein A chain variant of HSA Chr 18. Aberdam D 1994 Nature Genet 6:299 & & Burgeson RW 1994 Matrix Biol 00:000 & Richards AJ 1994 Genomics 22:237 1994 RW personal 9/21/94 9/21/94 R114108 Lama4 RW lama4 Lama004 laminin A, variant 4 LAMA4 6q21-q21 A human gene. A variant laminin A chain related to merosin (laminin A2). LAMA4 was once referred to as LAMA3. However, LAMA3 now used to refer to the kalinin/nicein A chain variant of HSA Chr 18. Richards AJ 1994 Genomics 22:237 X76939 (Hsa) 1994 RW personal 9/21/94 11/5/94 R114107 Lara RW lara Lara leukocyte adhesion receptor, alpha Symbol is just a temporary placeholder. Get proper symbol from GDB. Sequence data in mouse and human. May be listed as lymphocyte adhesion receptor alpha. X07640, M18044 (Hsa) 1994 RW personal 9/1/94 9/1/94 R113958 Lars RW lars Lars leucyl-tRNA synthetase Hom LARS 5cen-q11 Mapped in human and hamster. May have mouse homolog. Chr 13 is a good candidate. 2q 1994 RW personal 8/10/94 8/18/94 R111742 Lck2 RW Lck-2 lck2 Lck002 lymphocyte protein tyrosine kinase 2 Homolog named Lck2 is mapped in the rat to Chr 7. Lck1 is mapped to rat Chr 5. Nonreceptor tyrosine kinase that interacts with CD4 andf CD8 receptors. Transduce signals from T cell receptor. Szpirer C 1990 Genomics 6:679 7 (LCK2) 1990 RW personal 8/10/94 R111247 Lcn1 RW lcn1 Lcn001 lipocalin 1, tear LCN1 9q34 Tear prealbumin. Member of the lipocalin family. Extracellular proteins that bind lipophiles. Generally 18-20 kDa proteins. In humans 5 lipocalins cluster on Chr 9, ORM1, AMBP, PAEP, PGDS, and LCN1. Lassagne H 1993 Genomics 18:160 human clone 16 probe of Lassagne H 1993 RW personal 8/10/94 R111248 Lgalb RW Lgals2 lgalb, lgals2 Lgalb lectin, galactose binding, beta May be the same as Lgals2. Symbol is just a placeholder. Get proper GDB symbol. M57470, X14829 (Hsa) 1994 RW personal, nomenclature 8/31/94 9/19/94 R113947 Lgb RW lgb Lgb lactoglobulin, beta Major component of milk whey of ruminants, dogs, and pigs, but not humans. Reserved provisionally by RW based on sequence data in other mammals. Check with GBASE. Hayes HC 1993 Mammalian Genome 4:207 11q28, 3p28, 11q28 1993 RW personal 8/10/94 R111249 Lim1 RW lim1 Lim001 LIM/HD metal binding protein 1 A metal binding protein that contains a highly conserved LIM domain and homeodomain. May be involved in tissue differentiation. Originally characterized in Xenopus. Lim1 is expressed in CNS and renal tissues. Westphal H 1994 personal communication 1994 RW personal 1/22/95 1/22/95 R115299 Lim2 RW lim2 Lim002 LIM/HD metal binding protein 2 A metal binding protein that contains a highly conserved LIM domain and homeodomain. May be involved in tissue differentiation. Originally characterized in Xenopus. Westphal H 1994 personal communication 1994 RW personal 1/22/95 1/22/95 R115300 Lim3 RW lim3 Lim003 LIM/HD metal binding protein 3 A metal binding protein that contains a highly conserved LIM domain and homeodomain. May be involved in tissue differentiation. Originally characterized in Xenopus. Lim3 is epxressed in Rathke's pouch, pituitary, retina and in ventral hindbrain and spinal cord. Westphal H 1994 personal communication 1994 RW personal 1/22/95 1/22/95 R115301 Linflh RW linflh, lifh Linflh lens intermediate filament-like,heavy LINFLH 20 A human lens specific cytoskeletal protein gene characterized by Hess JF 1995. About 85 kDa. Hess JF 1995 Curr Eye Res 00:000 cDNA sequence for human (350 bp). 1995 RW personal 12/3/94 12/3/94 R115249 Linfll RW linfll, lifl Linfll lens intermediate filament-like,light LINFLL 3q21-q26 A human lens specific cytoskeletal protein gene characterized by Hess JF 1995. About 45 kDa. Hess JF 1995 Curr Eye Res 00:000 16 cDNA sequence for human (350 bp). Somatic cell hybrid analysis of human. 1995 RW personal 12/3/94 12/3/94 R115250 Lip3 RW lip3 Lip003 lipase 3, cytotoxic T lymphocyte Grusby M 1990 Cell 60:451 M30687 D 1990 RW personal 8/10/94 R111250 Lipox RW lipox Lipox lipoxygenase Symbol is just a temporary placeholder. Get proper symbol from GDB. J03960 (Rno), J03600 (Hsa) 1994 RW personal 9/1/94 10/17/94 R113961 Lmnc RW lmnc Lmnc lamin C X14170, M13451 (Hsa) 1994 RW personal 9/1/94 9/1/94 R113957 Lpo RW lpo Lpo lactoperoxidase 19q13, 11q13, 19q13 1993 RW personal 8/10/94 R111251 Lrp2 RW lrp2, gp330 Lrp002 low density lipoprotein related protein 2 / glycoprotein 330 LRP2 2q24-q31 A human gene expressed in renal proximal tubules. Involved in endocytosis of complexes of urokinase and plasminogen activator inhibitor. Korenberg JR 1994 Genomics 22:88 1994 RW personal 9/18/94 9/18/94 R114100 Lrpap1 RW lrpap1, rap Lrpap001 low density lipoprotein associated protein 1 LRPAP1 4p16.3-p16.3 A human gene that maps to a region associated with Wolf-Hirschhorn syndrome. Korenberg JR 1994 Genomics 22:88 & Van_Leuven F 1994 Genomics 24:78 1994 RW personal 9/18/94 11/30/94 R114101 Lsn1 RW Lsn-1 lsn1 Lsn001 leukosianin 1 Mapped in rat to Chr 1. In rat, no recombination with Mt1 locus and 0.13 recombination with Igf2. Provisionally reserved by RW. Check with GBASE. Get reference Lsn1 (1) 1993 RW personal 8/10/94 R111252 Lsn2 RW Lsn-2 lsn2 Lsn002 leukosianin 2 Mapped in rat to Chr 12. Provisionally reserved by RW. Check with GBASE. Get reference Lsn2 (12) 1993 RW personal 8/10/94 R111253 Madcam1 RW MAdCAM-1 madcam1 Madcam001 mucosal addressin cell adhesion molecule 1 An addressin expressed in Peyer's patch and mesenteric lymph nodes. Its homing receptor is a member of the cell surface integrin family, alpha4beta7. Briskin MJ 1993 Nature 363:461 1993 RW personal 8/10/94 R111254 Mana1 RW mana1 mana001 mannosidase alpha A1, cytoplasmic Hom MANA 15q11-qter Mapped in human and cat. Possible mouse homolog, perhaps on Chr 9 (RW Mar 94). Y B3 1994 RW personal 8/10/94 8/18/94 R111755 Map1a RW Mtap map1a, mtap Map001a microtubule-associated protein 1A Hom MAP1A 15q Check for correct gene symbol in mouse. Sequence data from human and rat. Lankopf A 1992 J Biol Chem 267:16561 & Lien LL 1994 Genomics 22:273 & Schoenfeld TA 1989 J Neurosci 9:1712 Both human and rat MAP1A encode about 10 kb transcript. 7095 nt encoding 2365 aa in the rat. The light chain LC2 is encoded at the 3Õ end 1994 RW personal, nomenclature 8/18/94 8/18/94 R113774 Map2c RW map2c Map002c microtubule associated protein 2C Hom MAP2C 17 Check that the name of this locus is correct. Mapped in human and cow. Possible mouse homolog, probably on Chr 11. 19 1994 RW personal 8/10/94 8/18/94 R111727 Mbpa RW mbpa Mbpa mannose binding protein A, serum Mapped in the rat to Chr 20. Symbol provisionally reserved by RW. Check with GBASE. Note that Mll1 and Mbl2 are also reserved symbols with very similar names. Get reference 16 (MBPA) 1993 RW personal 8/10/94 R111255 Mcp1 RW mcp1 Mcp001 transciption regulatory protein Mcp1 A POU 1 gene. NMDA receptor activation in differentiating cerebellar neurons regulates the expression of Mcp1. Note this is not the mast cell protease like 1 gene (see Mcpt-rs1 for this gene). Bulleit RF 1994 J Neurosci 14:1584 L13763 970 nt linear mRNA sequence. D 1993 RW personal 8/10/94 8/9/94 R111256 Mcptlp RW Mcp1, MUSPROTC mcptlp1, mcp1 Mcptlp mast cell protease like protein GBASE name is mast cell protease like 1 with the symbol Mcp1. This GBASE symbol is nonstandard, and should be Mcptl1 or Mcptlp. Suffix "1" is unnecessary. Changed provisionally by RW following Serafin's name. Serafin WF 1991 J Biol Chem 266:1934 M54401 4990 nt ds DNA sequence of 5 exons. 246 aa conceptual translation. 1991 RW personal, nomenclature 8/10/94 R111257 Mct1 RW Mev, Mct mct1, mev Mct001 monocarboxylate transporter Hamster gene that probably has mouse homolog. Transports lactate and pyruvate across cell membrane. Well characterized in erythrocytes. Expressed in heart myocytes. Probably not the same as liver MCT. Mev is a mutant allele. Sequence data from Garcia CK 1994 Cell 76:865 & Kim CM 1992 J Biol Chem 267:23113 M97382 (hamster), L25842 (hamster) 12 membrane spanning regions 1994 RW personal 8/10/94 3/24/94 R111700 Mdc RW mdc Mdc metalloprotease-like, disintegrin-like, and cysteine-rich protein Hom MDC 17q21 A human gene that may have a mouse homolog, perhaps on Chr 11. May be a tumor suppressor gene involved in human breast and ovarian cancers. May normally bind to cell surface integrin via its disintegrin domain. Emi M 1993 Nature Genet 5:151 Human gene more than 20 exons spanning about 20 kb. Open reading frame of 1572 bp in human. 139 aa amino terminal proprotein domain, 200aa metalloprotease like domain, 92 aa disintegrin domain and 93 aa carboxyl cysteine-ric domain. 194 RW personal 8/10/94 9/19/94 R111608 Me1 RW MUSHTHTRFA me1 Me001 helix-loop-helix transcription factor ME1 Helix-loop-helix transcription factor sequence. *Title* ME1 and GE1: Helix-loop-helix transcription factors expressed in at high levels in developing nervous system and in morphogenetically active regions . Neuman T 1992 Devel Bio ???:??? M97635 D 1992 RW personal 8/10/94 R111258 Mekk RW mekk, mapk, mek1 Mekk MEK kinase MAPK MEK kinase associated with raf. Involved in regulation of the MAP kinase network. Temporary symbol by RW. Caution: this locus may have already been assigned a symbol, possibly Mek1 on Chr 9. Lange-Carter CA 1993 Science XX:XXX L10103 1993 nomenclature 8/2/94 11/14/94 R113651 Mis RW mis Mis Mullerian inhibiting substance Symbol is just a temporary placeholder. Get proper symbol from GDB. Shen WH 1994 Cell 77:651 U09208 1994 RW personal 9/1/94 9/7/94 R113980 Mlm RW mlm Mlm melanoma susceptibility MLM 9p Cannon-Albright LA 1994 Genomics 23:265 In human this locus is linked to IFNA . Locus is distal to D9S171 and proximal to D9S736. 1994 9/18/94 9/18/94 R114082 Mmip10 RW mmip10 Mmip010 migration inhibitory factor (10K protein) Reserved by RW provisional, based on GenBank sequence and description. Check with GBASE. Wistow G 1993 PNAS 90:1272 migration inhibitory factor (10K protein) mRNA, 3' end. *Title* A macrophage migration inhibitory factor is expressed in the differentiating cells of the eye lens D 1993 RW personal 8/10/94 R111260 Mp70 RW Cxn50 Mp70, cxn50, gjb, gja Mp70 lens fiber protein 70 Connexin 50. Symbol and name should be revised. This is a gap junction membrane channel protein. White T 1992 Mol Bio Cell 3:711 M91243 D 1992 RW personal 8/10/94 R111261 Mpe16 RW mpe16, d16s469e mpe16 membrane protein E16 D16S469E 16q24.3-q24.3 E16 integral membrane protein. Widespread expression of a 5.3 kb transcript in brain, thymus, and retina, retinal pigment epithelium, heart, placental, and lung and liver, muscle, kidney of human. May have a mouse homolog. Maglott DR 1994 Genomics 23:303 8 M78741 (Hsa), T03373 (Hsa), M79133 (Hsa), M80244 (Hsa) 1994 9/18/94 10/7/94 R114089 Mptea RW MUSMEMPROT mptea, tea Mptea membrane protein Tea GenBank files of Aug 1, 1994 L29006 L29006: 3698 nt mRNA sequence. 1994 RW personal 8/9/94 10/17/94 R113770 Msh2 RW msh2, hnpcc, muts Msh002 mismatch repair gene 2 MSH2 A postreplication mismatch repair gene in human associated with hereditary nonpolyposis colon cancer. Homolog of the mutS gene in bacteria and yeast. This gene is normally responsible for detecting mismatched microsatellites. Its failure to function is a cause of some colon cancers.. Fishel R 1994 Science 266:1403 RW personal 12/13/94 12/13/94 R115258 mSlo RW Kcng mslo, kcna7, kcng mSlo potassium channel, calcium-dependent Uncertain of the relation of MSlo to Kcng or Kcna7. MSlo mRNA, complete cds. *Title* mSlo, a complex mouse gene encoding "maxi" calcium-activated potassium channels. Bulter A 1993 Science 261:221 L16912 1196 residue protein has 10 hydrophobic segments. clone mbrl 1993 RW personal 8/10/94 R111262 Msp23 RW msp23 Msp023 stress induced peritoneal macrophage protein, 23 kDa Shau H 1994 Immunogenetics 40:129 & Ishii T 1993 J Biol Chem 268:18633 1993 RW personal, nomenclature 9/1/94 10/17/94 R113969 Mug3 RW mug3 Mug003 murinoglobulin 3 A single chained member of the alpha 2 macroglobulin family of proteinase inhibitors. There are four or more Mug genes in the mouse. Overbergh L 1994 Genomics 22:530 1994 RW personal 9/10/94 9/10/94 R114032 Mug4 RW mug4 Mug004 murinoglobulin 4 A single chained member of the alpha 2 macroglobulin family of proteinase inhibitors. There are four or more Mug genes in the mouse. Overbergh L 1994 Genomics 22:530 1994 RW personal 9/10/94 9/10/94 R114033 Myd10 RW MyD10 myd10 Myd010 myoblast differentiation 10 Lord K 1990 Oncogene 5:387 X54331 D 1990 RW personal 8/10/94 R111263 Myd118 RW MyD118 myd118 Myd118 myoblast differentiation 118 A myeloid differentiastion primary response gene induced by multiple cytokines. Abdollhai A 1991 Oncogene 6:165 X54149 D 1991 RW personal 8/10/94 R111266 Myd21 RW MyD21 myd21 Myd021 myoblast differentiation 21 Lord K 1990 Oncogene 5:387 X54332 D 1990 RW personal 8/10/94 R111264 Myd88 RW MyD88 myd88 Myd088 myoblast differentiation 88 A novel myeloid differentiation primary reponse gene induced by Il6. Lord K 1990 Oncogene 5:1095 X51397 D 1990 RW personal 8/10/94 R111265 Myia RW myia Myia myosin I, alpha Widely expressed myosin I family gene. Sherr E 1993 J Cell Biol 120:1405 L00923 D 1993 RW personal 8/10/94 R111267 Myib RW myib Myib myosin I, beta Widely expressed myosin I family gene. Sherr E 1993 J Cell Biol 120:1405 L00923 D 1993 RW personal 8/10/94 R111268 Myig RW myig Myig myosin I, gamma Widely expressed myosin I family gene. Sherr E 1993 J Cell Biol 120:1405 L00923 D 1993 RW personal 8/10/94 R111269 Mylb RW Myl2, PLRLC myl1, plrlc Mylb myosin light chain 2 A novel regulatory mylsin light chain gene that distinguishes pre-B cell subsets and in Il7 inducible. The choice of symbol may be inappropriate although it is consistent with the GenBank symbol and name. Lee K 1992 J Biol Chem 267:15875 & Oltz E 1992 EMBO J 000:000 X65979, X65980, X65981, M91602 Three mRNA sequences D 1992 RW personal 8/10/94 R111270 Nabpk RW Nabpk Nabpk nucleic acid binding protein, hnRNP K-like A nucleic acid binding protein with homology to hnRNP K. Hahm K 1993 Nucleic Acids Res 21:3894 L19661 D clone pB1001 to pB1005 of Hahm K 1993 RW personal 8/10/94 R111271 Nagr1 RW nagr1 Nagr001 N-acetylglucosamine specific receptor 1, thyroid NAGR1 19p13.3-p13.2 A membrane thyroid receptor. One of two or three monomers that binds the prohormone of thyroid hormone (thyroglobulin). The receptor is a calicium dependent lectin of about 51 kDa. It appears to bind the prohormone and transport it from endosomes and the Golgi back to the plasma membrane where the prohormone is glycosylated and iodinated. Expressed in thyroid. Blank O 1994 Genomics 21:18 X72018 (Hsa) 1994 RW personal 10/29/94 10/29/94 R114370 Nat3 RW nat3 Nat003 arylamine N-acetyltransferase Kelly SL 1994 Biochem J 302:347 X72959 1436 bp genomic sequence. 1994 RW personal 10/6/94 10/6/94 R114180 Nbccs RW nbccs Nbccs nevoid basal cell carcinoma syndrome NBCCS 9q22-q31 A human locus that may have a mouse homolog. Also known as Gorlin syndrome. In human the NBCCS region is flanked by D9S12 and D9S180. A Yac contig spanning a 1.65 MB region including NBCCS is described in Morris (1994). NBCCS is closely linked to xeroderma pigmentosum complementing group A (XPAC) and Fanconi anaemia group C (FACC) genes. Morris DJ 1994 Genomics 23:23 1994 RW personal 9/16/94 10/7/94 R114067 Nck RW Grb4 nck, grb4 Nck transduction adapter protein, Nck Hom NCK 3q21 Get proper gene name. Binds to activated growth factor receptors. Overexpression of Nck leads to oncogenic trannsformation of mouse fibroblasts. Has a role in mitogenic signaling. Margolis B 1992 PNAS 89:8894 & Huebner K 1994 Genomics 22:281 9 Contains one SH2 and three SH3 Src homology domains. Sequence of cDNA in mouse by Margolis B 1992. Position on Chr 9 of mouse suggested by homology only. Possible linkage to Rho and Tf. 1992 RW personal, nomenclature 8/18/94 11/14/94 R113775 Ncl-psE4 RW Ncl-ps1 nclpse4, nclps1 Nclpse004 nucleolin, pseudogene E4 An intronless pseudogene. Bourbon H 1991 Gene 101:273 M37985 D 1991 RW personal 8/10/94 R111272 Ndpk RW ndpk Ndpk NDP kinase Symbol is just a temporary placeholder. Get proper symbol from GDB. M55331 (Rno), M36981 (Hsa) 1994 RW personal 9/1/94 9/1/94 R113963 Ndufv1 RW ndufv1 Ndufv001 mitochondrial complex, 51 kDa subunit Hom NDUFV1 11q13 A human gene that may have a mouse homolog Ali ST 1993 Genomics 18:435 1993 RW personal 8/10/94 8/18/94 R111549 Net1 RW net1 Net001 norepinephrine transporter 1 Hom NET1 16 A human gene likely to have a mouse homolog. Gelernter J 1993 Genomics 18:690 1993 RW personal 8/10/94 8/18/94 R111550 Neu RW c-erb-B2 neu, p185, cerbb2 Neu neu receptor protooncogene An epidermal growth factor receptor (p185) relative isolated from chemically induced rat neuroblastomas. Ben-Levy R 1992 J Biol Chem 267:17304 X66236, X03362 (Rno), X03363 (Hsa) Promoter region sequence of 721 bp. 1992 RW personal 8/10/94 8/29/94 R113628 Nfkb2 RW LYT-10 nfkb2, lyt10 Nfkb002 nuclear factor of kappa light chain gene enhancer in B cells 2 NFKB2 10q24 Schmid RM 1991 Nature 352:733 & Liptay S 1992 Genomics 13:287 1994 9/10/94 9/10/94 R114019 Nfkb3 RW nfkb3, p65 Nfkb003 nuclear factor of kappa light chain gene enhancer in B cells 3 NFKB3 11q12 Nolan GP 1991 Cell 64:961 & Ruben SM 1991 Science 251:1490 & Deloukas P 1994 Genomics 19:592 1994 9/10/94 10/7/94 R114020 Nfkbi RW nfkbi Nfki nuclear factor of kappa light chain gene enhancer in B cells inhibitor NFKBI 14q13 Note that Nfkb1 is the mouse homolog of human NFKB1 located on HSA 4q24 and mouse Chr 3. Not the same as Nfkb1. 1994 nomenclature 9/10/94 10/7/94 R114021 Nfn RW nfn Nfn neurofascin Cell adhesion molecule. Neural. Transmembrane glycoprotein. Member of the immunoglobulin superfamily. 1993 RW personal 8/10/94 R111274 Ngfi1 RW ngfi1 Ngfi001 nerve growth factor induced gene 1 Mapped in rat to Chr 18. If there is a mouse homolog, then it is probably on Chr 18 also. Not mapped in human (1993). 18 (NGF1) 1993 RW personal 8/10/94 R111275 Nhbr1 RW N10 nhbr1, n10 Nhbr001 nuclear hormonal binding receptor 1 A putative homone binding receptor. Once known as N10 gene. Ryseck R 1989 EMBO J 8:3327 M33212, X60132 D 1989 RW personal 8/10/94 R111276 Nir RW nir Nir NADPH imenadine reductase Symbol is just a temporary placeholder. J02679 (Rno), J03934 (Hsa) enzyme (reductase) 1994 RW personal 9/1/94 9/1/94 R113962 Nknb RW nknb Nknb not known Hom NKNB 12q13-q21 Mapped in human and cow. Listed by S. O-5Brien 1994. Possible mouse homolog, may map to Chr 10. 5 1994 RW personal 8/10/94 8/18/94 R111752 Nksf1 RW nksf1 Nksf001 interleukin 12 subunit Nksf1 NKSF1 5q33 Get proper gene name. This is a one of the two subunits of IL12. Probably has a mouse homolog. Check nomenclature. In human this gene is located close to the putative tumor suppressor gene associated with 5q syndrome. Sieburth D 1992 Genomics 14:59 & Boultwood J 1994 Genomics 19:425 1994 RW personal 10/1/94 10/7/94 R114110 Nm23 RW nm23, mrp Nm023 tumor metastatic process associated protein NM23 A gene associated with low tumor metastatic potential. Also called metastasis reducing protein. Steeg P 1988 J National Cancer Inst 80:200 & Leone A 1991 Cell 65:25 M35970, M65037 3Õ end of gene, 664 bp. D 1988 RW personal 8/10/94 7/20/94 R111277 Noggin RW noggin Noggin noggin Noggin and follistatin induce anterior part of the brain. Noggin is a soluble protein that is expressed in the Spemann organizer and later in the notochord. Noggin is not an inhibitor of activin. Lamb T 1993 Science 262:713 1994 RW personal 8/20/94 8/23/94 R113789 Nopp RW nopp Nopp neurite outgrowth promoting protein Check for proper symbol and name. This symbol is just a temporary placeholder. Sequenced in mouse and human. M34327, X55110 (Hsa) 1994 RW personal 9/1/94 9/1/94 R113964 Nph1 RW nph1, esrd Nph001 nephronophthisis 1 Hom NPH1 2q13 Locus mapped in human caused juvenile nephronophthisis. May have mouse homolog, possibly on Chr 2. Also called recessive medullary cystic kidney disease. Medhioub M 1994 Genomics 22:296 Maps in human between D2S293 and D2S121. May map to mouse Chr 2. 1994 RW personal 8/18/94 8/23/94 R113776 Nrp38 RW N038 nrp38, n038 Nrp038 nucleoplasmin related protein 38 A major protein constituent of mammalian nuclei, a nucleolar protein once termed N038. Schmidt-Zachmann M 1988 Chromosoma 96:417 M33212 D 1988 RW personal 8/10/94 R111278 Ntd RW Ntd Ntd 5' nucleotidase Temporary symbol. Just a placeholder. Use human symbol. 3.1.3.5 X55740 (Hsa), J05214 (Rno) Unmapped mouse locus. 1994 RW personal 8/28/94 10/17/94 R113929 Ntk RW ntk Ntk Ntk tyrosine protein kinase L27738 1734 bp ss-mRNA 1994 RW personal, nomenclature 8/10/94 8/1/94 R113632 Nts RW nts Nts neurotensin Hom NTS 12 Neurotensin/neuromedian N. Mapped in human and sheep. Homology relations suggest that the mouse homolog may map to Chr 10. 3q12-q14 1993 RW personal 8/10/94 8/18/94 R111279 Oa1 RW oa1 Oa001 ocular albinism 1, X-linked OA1 Xp22.3-p22.2 X-linked Nettleship-Fall ocular albinisum affects about 1 in 150,000 human males. Associated with poor acutiy, nystagmus, photophobia. No known mouse homolog (Sept 94). Cutaneous pigmentation appears normal. Many giant pigment granules in skin and retinal pigment epithelium. OA1 is probably a disorder of pigment distribution or transfer. Nettleship E 1909 Trans Ophthalmol Soc UK 29:57 & Falls HF 1951 Am J Ophthalmol 43:41 & Bergen AAB 1991 Hum Genet 88:162 X In human OA1 is between DXS85 and DXS143 interval. Close to the Kallmann syndrome locus (KAL) and STS. Mouse homologue, if any, might be on distal X and within 8-10 cM of Sts. STS 1909 RW 9/18/94 10/7/94 R114091 Odor1 RW odor1 Odor001 odorant receptor 1, K7 An odorant receptor gene. Ressler K 1993 Cell 73:597 L14566 D 1993 RW personal 8/10/94 R111280 Odor2 RW odor2 Odor002 odorant receptor 2, M50 An odorant receptor gene. Ressler K 1993 Cell 73:597 L14567 D 1993 RW personal 8/10/94 R111281 Odor3 RW odor3 Odor003 odorant receptor 3, K18 An odorant receptor gene. Ressler K 1993 Cell 73:597 L14568 D 1993 RW personal 8/10/94 R111282 Odor4 RW odor4 Odor004 odorant receptor 4, K4 An odorant receptor gene. Ressler K 1993 Cell 73:597 L14569 D 1993 RW personal 8/10/94 R111283 Omd RW omd Omd orotidine-5'-monophosphate decarboxylase Ohmstede C 1986 J Biol Chem 261:4276 M29395 D 1986 RW personal 8/10/94 R111284 ope RW ope ope opaque eye Mutant has large eyes with white centers. Most likely due to lens rupture. Recessive autosomal mutation. Given provisional symbol by RW. Check with Juriloff and GBASE. Juriloff DM Mouse Genome 91:551 eye (lens or cataract) 1993 RW personal 8/10/94 R111285 Ostn RW ostn Ostn osteonectin Symbol is just a temporary placeholder. Get proper symbol from GDB. X04017, J03040 (Hsa) 1994 RW personal 9/7/94 9/7/94 R113981 Ostp RW ostp Ostp osteopontin Symbol is just a temporary placeholder. Get proper symbol from GDB. M14656 (Rno), X13694 (Hsa) 1994 RW personal 9/7/94 9/7/94 R113982 P15tr RW p15 P015tr p15 DNA binding transcription regulator 15 kDa protein. Sequenced in human. Check symbol and name. Kretzschmar M 1994 Cell 78:525 X79805 (Hsa) 1994 RW personal 9/1/94 10/17/94 R113967 Pagb RW pagb Pagb proliferation-associated gene B, pseudogene PAGB 9p22 A human pseudogene that may have a mouse homolog. Prosperi MT 1994 Genomics 19:236 X72297 (Hsa) 1994 RW personal 12/15/94 12/15/94 R115265 Pbpc1 RW Pbpc-1 pbpc1 Pbpc001 prostatic binding protein c 1 Mapped in rat to 5q31. Reserved by RW. Check with GBASE. 5q31 (PBPC1) 1993 RW personal 8/10/94 R111286 Pbpc2 RW Pbpc-2 pbpc2 Pbpc002 prostatic binding protein c 2 Mapped in rat to 5q31 or q21. Reserved by RW. Check with GBASE. 5q31 or q21 (PBPC2) 1993 RW personal 8/10/94 R111287 Pbpc3 RW Pbpc-3 pbpc3 Pbpc003 prostatic binding protein c 3 Mapped in rat to 5q31 or q21. Reserved by RW. Check with GBASE. 5q31 or q21 (PBPC3) 1993 RW personal 8/10/94 R111288 Pc4 RW pc4 Pc004 positive cofactor 4 An upsteam transcription stimulator. Data on human sequence only. Ge H 1994 Cell 78:513 1994 RW personal 9/1/94 10/17/94 R113966 Pccb RW pccb Pccb propionyl-CoA carboxylase, beta subunit Hom PCCB 3q21-q22 The 55 kDa subunit of PCC, a mitichondial biotin-dependent enzyme involved in degradation of branched chain amino acids and fatty acids of odd numbered chain length.Mapped in rat to Chr 8, dog to U10, human to 3q21-q22. Mouse homolog may map to Chr 9. Szpirer 1989 Cytogenet Cell Genet 50:23 & Lamhonwah Am 1994 Genomics 19:500 U10 8 (PCCB) 6.4.1.3 X73424 (Hsa) 1989 RW personal 8/10/94 10/6/94 R111289 Pcgp1 RW pcgp1, pc1 Pcgp001 plasma cell membrane glycoprotein PC-1 Symbol is just a temporary placeholder. Get proper symbol from GDB. J02700, M57736 (Hsa) 1994 RW personal 9/7/94 9/7/94 R113987 Pebp2a2 RW Pea2 pebp2a2, pea2 Pebp002a002 polyomavirus enhancer binding protein 2 alpha subunit 2 Bae SC 1993 Oncogene 8:809 D14637 mRNA, complete cds, 2176 bp. 1994 RW personal 8/10/94 8/1/94 R113629 Pedf RW pedf pigment epithelium derived factor PEDF 17p13.1 Expressed in retinal pigment epithelium. Induces extensive neuronal differential in human retinoblastoma cells. Tombran-Tink J 1994 Genomics 19:266 1994 RW personal 12/15/94 12/15/94 R115266 Pep#1 RW pep# pep# peptidase "get Number" imidodipeptidase / prolidase Symbol is just a temporary placeholder. Probably in one of the Pep# loci. Also known as prolidase. An exopeptidase expressed in many tissues. Initially purified from pig kidney. Activity of the enzyme is enhanced by Mn++. 3.4.3.7 1994 RW personal 9/8/94 10/17/94 R113992 Pep#2 RW pep# pep# peptidase "get Number" iminodipeptidase / prolinase Symbol is just a temporary placeholder. Probably in one of the Pep# loci. Also known as prolinase. An exopeptidase expressed in many tissues. Initially purified from pig kidney. Activity of the enzyme is enhanced by Mn++ and Cd++. 3.4.3.6 1994 RW personal 9/8/94 10/17/94 R113993 Pepn RW Cd13, p150 pepn, cd13, p150 Pepn aminopeptidase N/ complement designation 13 Hom PEPN 15q25-q26 Mapped in human and pig. Sequenced in rat and human. An exopeptidase similar in action to intestinal tripeptidase. Inhibited by cysteine, Cd++ and Hg++. Rapidly inactivated by low pH. 7cen-q21 3.4.1.3 M25073 (Rno), M223224 (Hsa) Mouse homolog may map to Chr 7 or 9 (RW Mar 94). 1994 RW personal 8/10/94 9/8/94 R111756 Pf4 RW pf4 Pf004 platelet factor 4 Hom PF4 4q12-q21 Mapped in human and rat. May have mouse homolog. Chr 5 is a good candidate (RW Mar 94). 14 1994 RW personal 8/10/94 8/18/94 R111733 Pfkfb2 RW pfkfb2 Pfkfb002 6-phosphofructo-2-kinase / fructose-2,6-biphosphatase 2 Hom PFKFB2 1q31 Mapped in human and rat. Mouse homolog likely to be on Chr 1. 13q24 RW personal 8/10/94 8/18/94 R111708 Pfkp RW Pfk-4 pfkp Pfkp 6- phosphofructokinase, platelet PFKP 10p15.2-p15.3 A human gene that probably has a mouse homolog. Simpson CJ Biochem Biophys Res Comm 180:197 2.7.1.11 M64784 (Hsa) enzyme (unclassified) 1980 RW personal 9/18/94 10/7/94 R114097 Pga RW pga pga pepsinogen A, group 1 PGA 11q13 Human PGA3, PGA4, and PGA5 map to 11q13. Pig PGA maps to 2p17. May have mouse homolog on Chr 19 or 7. 2p17 1994 RW personal, nomenclature 8/10/94 3/26/94 R111720 Pggg RW pggg Pggg protein glutamine gamma glutamyltransferase Symbol is just temporary placeholder. Check GDB for proper symbol. M57263 (Rno), M55183 (Hsa) 1994 RW personal 9/10/94 9/10/94 R113995 Pgm RW pgm Pgm phosphglycerate mutase Symbol is just a temporary placeholder. Get proper symbol from GDB. M31835 (Rno), M18172 (Hsa) 1994 RW personal 9/7/94 9/7/94 R113986 Pgp RW pgp Pgp phosphoglycolate phosphatase Hom PGP 16p13.3 Mapped in human, mink, fox, and dog. May have a mouse homolog, perhaps on Chr 11. U21 3 14 1994 RW personal 8/10/94 8/18/94 R111758 Pigr RW pigr Pigr polymeric immunoglobulin receptor Hom PIGR 1q31-q41 Mapped in human and cow. Mouse homolog likely to map to Chr 1. 16 RW personal 8/10/94 8/18/94 R111709 Pigt RW Pigt Pigt phosphatidylinositol transfer protein Symbol is just a temporary placeholder. Get proper symbol from GDB. M25758 (Rno), M73704 (Hsa) 1994 RW personal 9/7/94 9/7/94 R113985 Pki RW pki Pki protein kinase inhibitor X57345, X57346, X57347, X57348 1994 RW personal 8/10/94 8/1/94 R113636 Pklpb RW plpb Pklpb prolactin like protein B Mapped in rat to Chr 17. Provisionally reserved by RW. Check with GBASE. Levan 1991 Genomics 10:699 17 (PLPB) protein (unclassified) 1991 RW personal 8/10/94 R111290 Pkrac RW pkrac Pkrac protein kinase related to A and C kinases Putative gene. Bousquets X 1992 Unpublished M94335 (Mmuscaris) 1513 nt linear ss mRNA from Mus muscaris. 480 aa conceptual translation. D 1992 RW personal 8/10/94 R111291 Pla RW pla Pla peroxisomal L-alanine / glyoxylate Symbol is just a temporary placeholder. Get proper symbol from GDB. M35270 (Rno), X53414 (Hsa) 1994 RW personal 9/7/94 9/7/94 R113984 Plca RW Plca Plca phospholipase C, alpha Adams M 1992 Nature 357:367 & Hempel W 1991 J Immunol 146:3713 M73329 D 1993 RW personal 8/10/94 R111292 Plfp RW plfp Plfp proliferin 2, placental Requires confirmation that this is a novel locus. Linzer D 1985 PNAS 82:4356 K03235 mRNA, complete cds. D 1985 RW personal 8/10/94 R111293 Plko RW plko Plko plakoglobin Component of cytoplasmic surface of desmosome. Interacts with desmoglein and cadherins in zonula adherens junction. Related to beta catinin and Drosophila "armadillo" gene. protein (membrane) 1993 RW personal 8/10/94 R111294 Plpa RW plpa Plpa prolactin like protein A Mapped in rat to Chr 17. Provisionally reserved by RW. Check with GBASE. Levan 1991 Genomics 10:699 17 (PLPA) protein (unclassified) 1991 RW personal 8/10/94 R111295 Plpc RW plpc Plpc prolactin like protein C Mapped in rat to Chr 17. Provisionally reserved by RW. Check with GBASE. Levan 1991 Genomics 10:699 17 (PLPC) protein (unclassified) 1991 RW personal 8/10/94 R111296 Pole RW pole Pole DNA polymerase, epsilon POLE 12q24.3 Szpirer J 1994 Genomics 20:223 Y 12 B D 1994 RW personal 8/10/94 8/1/94 R113642 Ppat RW ppat Ppat phosphoribosyl pyrophosphate amidotransferase Hom PPAT 4p16.3-q21 Mapped in human and sheep. Possible mouse homolog. Chr 6 is good candidate (RW Mar 94). 6,4 1994 RW personal 8/10/94 8/18/94 R111731 PpMo54 RW ppmo54, mo54 Ppmo054 protective protein Mo54 Symbol is just a temporary placeholder. J05261, M22960 (Hsa) 1994 RW personal 9/7/94 10/17/94 R113990 Pref1 RW Pref-1, MUSADDIFF pref1 Pref001 adipocyte differentiation associated protein 1 Adipocyte differentiation-associated protein mRNA, complete cds. *Title* Pref-1, a protein with EGF-like repeats, inhibits adipocyte differentiation. Reserved by RW provisional. Check with GBASE . Smas C 1993 Cell 73:725 L12721 1993 RW personal 8/10/94 R111297 Prkacb RW prkacb Prkacb protein kinase, cAMP dependent, catalytic, beta Hom PRKACB Mapped in human and pig. Possible mouse homolog on Chr 3 or 4. RW personal 8/10/94 8/18/94 R111704 Prkar1a RW prkar1a prkar001a protein kinase, cAMP dependent regulatory, type 1 alpha Hom PRKAR1A 17q23-q25 Mapped in human to 17q23-q25. A mouse homolog may map to Chr 11. 12p13-q14 1994 RW personal 8/10/94 8/18/94 R111724 Prkgr1b RW prkgr1b, pgk Prkar002b protein kinase, cGMP dependent regulatory, type 1 beta PRKGR1B 10q11.2-q11.2 A human gene that probably has a mouse homolog. Sandberg M 1989 FEBS Lett 255:321 & Tunnacliffe A 1994 Hum Genet 93:313 D90075 (Hsa), Y07512 (Hsa) 1989 RW personal 9/18/94 10/7/94 R114098 Pros30 RW pros30 Pros030 prosomal protein 30 p30-33 kDa. M29859 (Rno), M64992 (Hsa) 1994 RW personal 9/7/94 9/7/94 R113988 Prr1 RW Prr-1 prr1 Prr001 ventral prostatic proline rich polypeptide Mapped in rat to Chr 10. Reserved provisionally by RW. Not in GBASE July 1993. Check with GBASE. 10 (PRR1) 1993 RW personal 8/10/94 R111298 Ptp1 RW ptp1 ptp001 protein phosphotyrosyl phosphatase 1B Symbol is provisional. May already have approved mouse symbol. M33962 (Rno), M33689 (Hsa) 1994 RW personal 9/10/94 9/10/94 R113994 Pxl RW pxl Pxl paxillin Tyrosine-phosphorylated cytoplasmic membrane-associated protein. Binds to vinculin. protein (membrane) 1993 RW personal 8/10/94 R111299 Rab10 RW rab10 Rab010 ras-related GTP-binding protein 10 Dog sequence data. 1993 RW personal 8/10/94 R111307 Rab11 RW rab11 Rab011 ras-related GTP-binding protein 11 Dog sequence data. 1993 RW personal 8/10/94 R111308 Rab12 RW rab12 Rab012 ras-related GTP-binding protein 12 mRNA sequence data only. May not be a gene. Temporary. Chavrier P 1992 Gene 112:261 M79302 D 1992 RW personal 8/10/94 R111309 Rab13 RW rab13 Rab013 ras-related GTP-binding protein 13 mRNA sequence data only. May not be a gene. Temporary. Chavrier P 1992 Gene 112:261 M79303 D 1992 RW personal 8/10/94 R111310 Rab14 RW rab14 Rab014 ras-related GTP-binding protein 14 mRNA sequence data only. May not be a gene. Temporary. Chavrier P 1992 Gene 112:261 M79304 D 1992 RW personal 8/10/94 R111311 Rab15 RW rab15 Rab015 ras-related GTP-binding protein 15 mRNA sequence data only. May not be a gene. Temporary. Chavrier P 1992 Gene 112:261 M79305 D 1992 RW personal 8/10/94 R111312 Rab16 RW rab16 Rab016 ras-related GTP-binding protein 16 mRNA sequence data only. May not be a gene. Temporary. Chavrier P 1992 Gene 112:261 M79306 D 1992 RW personal 8/10/94 R111313 Rab17 RW rab17 Rab017 ras-related GTP-binding protein 17 mRNA sequence data only. May not be a gene. Temporary. Chavrier P 1992 Gene 112:261 M79307 D 1992 RW personal 8/10/94 R111314 Rab18 RW rab18 Rab018 ras-related GTP-binding protein 18 mRNA sequence data only. May not be a gene. Temporary. Chavrier P 1992 Gene 112:261 M79308, L04966 D 1992 RW personal 8/10/94 R111315 Rab19 RW rab19 Rab019 ras-related GTP-binding protein 19 mRNA sequence data only. May not be a gene. Temporary. Chavrier P 1992 Gene 112:261 M79309 D 1992 RW personal 8/10/94 R111316 Rab1b RW rab1b Rab001b ras-related GTP-binding protein 1b mRNA sequence data only. May not be a gene. Temporary. Chavrier P 1992 Gene 112:261 M79314 D 1992 RW personal 8/10/94 R111300 Rab2 RW rab2 Rab002 ras-related GTP-binding protein 2 J02999 (Rno), X12953 (Hsa) D 1994 RW personal 9/10/94 9/10/94 R113996 Rab20 RW rab20 Rab020 ras-related GTP-binding protein 20 mRNA sequence data only. May not be a gene. Temporary. Chavrier P 1992 Gene 112:261 M79310 D 1992 RW personal 8/10/94 R111317 Rab4b RW rab4b Rab004b ras-related GTP-binding protein 4b Dog sequence data. Check with GBASE. 1993 RW personal 8/10/94 R111301 Rab5b RW rab5b Rab005b ras-related GTP-binding protein 5b mRNA sequence data only. May not be a gene. Temporary. Chavrier P 1992 Gene 112:261 M79311 D 1992 RW personal 8/10/94 R111302 Rab5c RW rab5c Rab005c ras-related GTP-binding protein 5c mRNA sequence data only. May not be a gene. Temporary. Chavrier P 1992 Gene 112:261 M79312 D 1992 RW personal 8/10/94 R111303 Rab6 RW rab6 Rab006 ras-related GTP-binding protein 6 mRNA sequence data only. May not be a gene. Temporary. Chavrier P 1992 Gene 112:261 M79313 D 1992 RW personal 8/10/94 R111304 Rab8 RW rab8 Rab008 ras-related GTP-binding protein 8 Dog sequence data. 1993 RW personal 8/10/94 R111305 Rab9 RW rab9 Rab009 ras-related GTP-binding protein 9 Dog sequence data. 1993 RW personal 8/10/94 R111306 Rage RW rage Rage receptor for advanced glycosylation end products A mouse mRNA sequence that probably defines a new locus. Lundh ER 1994 unpublished L33412 mRNA sequence 1994 RW personal, nomenclature 9/1/94 10/17/94 R113968 Rcn1 RW rcn1 Rcn001 retinal cell number 1 Q R A major neurogenic quantitative trait locus that controls the size of the population of retinal ganglion cells. High strains (DBA/2J, C57BL/Ks, AKR, 129, BALB/c, C3H, PL, and CE) have about 65000 ganglion cells, low strains (A, C57BL/6, SJL, CBA) have about 54000 ganglion cells. Variation at this locus may account for a difference of 5000 to 8000 cells. Williams RW 1995 personal communication 11 H L H H H L H L BXD strain distribution most consistent with distal on Chr 11 (lod about 3.5 to 4.0; closest match to Hoxb). This region of the C57BL/Ks has DBA/2J alleles (Naggert JK 1995 Mamm Genome 6:131). U D D D D U D B U D D U B D D D U B D B U U U U B D 1994 10/30/94 2/23/95 R114379 Rdc1 RW rdc1 Rdc001 G protein coupled adenosine receptor, RDC1 RDC1 2q37-q37 Get proper gene name from Libert reference. Mapped in human. May have a mouse homolog. Libert F 1991 Genomics 11:225 1991 RW personal 9/18/94 10/7/94 R114086 Recw1 RW recw1 Recw001 ecotropic murine virus receptor W1 Receptor W1. This putative ecotropic retrovirus receptor gene encodes a multiple membrane-spanning protein that confers susceptibility to virus infection. Check current (1994) status of this gene. Albritton LM 1989 Cell 57:659 200 D 1989 RW personal 9/1/94 9/1/94 R113970 Relb RW RelB relb Relb relB transcription factor A transcription activator that can interact with p50-NF-kappa-B. Ryseck RP 1992 Mol Cell Bioll 12:674 M83380 (Mmuscaris) 2055 nt linear ss mRNA from Mus muscaris. 558 aa conceptual translation. D 1992 RW personal 8/10/94 R111318 Reverb RW reverb Reverb Rev-Erb beta orphan nuclear receptor From GenBank, July 1, 1994. Title is ÒCross-talk among RORa1 and REV-ERB family of orphan nuclear receptors.Ó Forman BM 1994 Unpublished. U09504 U09504: 1629 nt mRNA sequence. 1994 RW personal 8/9/94 10/17/94 R113772 Rnu1b2 RW rnu1b2 Rnu001b002 U1b small nuclear RNA 2 Second copy in cluster. Howard E 1986 Nucleic Acids Res 14:9811 X01623, M32270 D 1986 RW personal 8/10/94 R111319 Rnu1b6 RW rnu1b6 Rnu001b006 U1b small nuclear RNA 6 Howard E 1986 Nucleic Acids Res 14:9811 M32271 D 1986 RW personal 8/10/94 R111320 Rnu4a RW rnu4a Rnu004a U4 small nuclear RNA, type a 5.7S Kato N 1981 Biochem Biophys Res Comm 99:1477 M10328 D RNA (unclassified) 1981 RW personal 8/10/94 R111321 Rnu4b RW rnu4b Rnu004b U4 small nuclear RNA, type b 5.7S Kato N 1981 Biochem Biophys Res Comm 99:1477 M18004 D RNA (unclassified) 1981 RW personal 8/10/94 R111322 Rnu5 RW rnu5 Rnu005 U5 small nuclear RNA 5S Hamada K 1989 Mol Cell Biol 9:4345 M29240, M29241, M29243, M29244, M29245, M29246, M10336 D RNA (unclassified) 1989 RW personal 8/10/94 R111323 Ror1 RW ror1 Ror001 Ror 1 receptor ROR1 Initially isolated from human cDNA. Tyrosine kinase domain typical of growth factor receptors of the Trk family. Developmentally expressed in rat embryos before E16. Ligand is not yet known. Masiakowski P 1992 J Biol Chem 267:26181 M97675 (Hsa) Human cDNA sequence D 1992 RW personal 8/10/94 R111324 Ror2 RW ror2 Ror002 Ror 2 receptor ROR2 Initially isolated from human cDNA. Tyrosine kinase domain typical of growth factor receptors of the Trk family. Ror2 has a protein kinase activity in vitro. Developmentally expressed in rat embryos before E16. Ligand is not yet known. Masiakowski P 1992 J Biol Chem 267:26181 S51526 (Hsa) Human cDNA sequence D 1992 RW personal 8/10/94 R111325 Rpad RW adrp, rd Rpad retinitis pigmentosa, autosomal dominant adRP 7p A human mutation in a 2 cM interval between D7s526 and D7S484. About 10 cM away from DCMD locus. May have a mouse homolog. Symbol modified by RW. Mouse symbol probably will conform to the Rd# model. Ingelhearn CF 1993 Nature Genet 4:51 1993 RW personal, nomenclature. 9/18/94 10/7/94 R114093 Rpl17 RW rpl17 Rpl017 ribosomal protein L17 gene family RPL17 X58200 (Rno), X52839 (Hsa) RNA (unclassified) 1994 RW personal 9/10/94 9/10/94 R113997 Rpo2-3 RW rpo23, polr2c Rpo002-003 RNA polymerase 2-3 POLR2C 16q13-q21 DNA dependent RNA polymerase II. Made up of 10 to 14 polypeptides or subunits ranging in size from 220 to 10 kDa. In human these subunits map to 17p13, 4q12, 16q13-q21, 19p13.3 and 19q12. This is the 33 kDa subunit. Acker J 1994 Genomics 20:496 1994 9/10/94 9/10/94 R114013 Rpo2-4 RW rpo24, polr2e Rpo002-00E RNA polymerase 2-4 POLR2E 19p13.3 DNA dependent RNA polymerase II. Made up of 10 to 14 polypeptides or subunits ranging in size from 220 to 10 kDa. In human these subunits map to 17p13, 4q12, 16q13-q21, 19p13.3 and 19q12. This is the 25 kDa subunit. Acker J 1994 Genomics 20:496 1994 9/10/94 9/10/94 R114014 Rps11 RW rps11 Rps011 ribosomal protein S11 gene family K03250 (Rno), X06617 (Hsa) RNA (unclassified) 1994 RW personal 9/10/94 9/10/94 R113998 Rps17 RW rps17 Rps017 ribosomal protein S17 K02933 (Rno), M13932 (Hsa) 1994 RW personal 9/10/94 9/10/94 R113999 Rsu1 RW rsu1 Rsu001 Ras suppresson protein 1 Hom RSU1 10 Miouse gene has been sequenced. Tsuda T 1993 Genomics 18:461 GET D 1993 RW personal 8/10/94 9/18/94 R111552 Saa-ps1 RW psi-SAA saaps1, psisaa Saaps001 serum amyloid A, pseudogene 1 Lowell C 1986 J Bio Cell 261:8442 D 1986 RW personal 8/10/94 R111326 Scin RW Sc scin, sc Scin scinderin This enzyme cleaves actin in secretory cells. Activity of scinderin associated with increased vesicular fusion to membrane. Gene has been sequenced in cow by Trifano and colleagues. Functional overlap with gelsolin. Trifano 1994 personal communication 1994 RW personal 8/10/94 3/24/94 R111555 Sep RW sep Sep serine esterase like protein Symbol is just a placeholder. Use GDB nomenclature, if available. M12302, J03189 (Hsa) D P enzyme (serine protease) 1994 RW personal 9/10/94 9/10/94 R114001 Serp RW serp Serp serine protease A mast cell tryptase. Kwon B 1988 J Exp Med 168:1839 & Huang R 1993 Scand J Immunol 38:359 M36900, M36901, M36902, L31853 mRNA complete cds derived from cytolytic T lymphocytes. D 1988 RW personal 8/10/94 7/20/94 R111327 Sip1 RW Sip1 Sip001 synaptotagmin interacting protein 1 One of a class of serine/threonine protein kinases that contain a common C-domain that binds to Syt4. Isolated using the two-hybrid method (LEX-Syt4 fusion protein as bait). Probably involved in synaptic vesicle movement. A homolog of the C. elegans Unc51 gene. Sip1 is expressed widely in brain, but also in kidney. Morgan JI 1994 personal communication 1994 RW personal 12/13/94 12/13/94 R115251 Sip2 RW Sip2 Sip002 synaptotagmin interacting protein 2 One of a class of serine/threonine protein kinases that contain a common C-domain that binds to Syt4. Isolated using the two-hybrid method (LEX-Syt4 fusion protein as bait). Probably involved in synaptic vesicle movement. A homolog of the C. elegans Unc51 gene. Sip2 is more widely expressed than Sip1. Morgan JI 1994 personal communication 1994 RW personal 12/13/94 12/13/94 R115252 Sip3 RW Sip3 Sip003 synaptotagmin interacting protein 3 One of a class of serine/threonine protein kinases that contain a common C-domain that binds to Syt4. Isolated using the two-hybrid method (LEX-Syt4 fusion protein as bait). Probably involved in synaptic vesicle movement. A homolog of the C. elegans Unc51 gene. Morgan JI 1994 personal communication 1994 RW personal 12/13/94 12/13/94 R115253 Sip4 RW Sip4 Sip004 synaptotagmin interacting protein 3 One of a class of serine/threonine protein kinases that contain a common C-domain that binds to Syt4. Isolated using the two-hybrid method (LEX-Syt4 fusion protein as bait). Probably involved in synaptic vesicle movement. A homolog of the C. elegans Unc51 gene. Morgan JI 1994 personal communication 1994 RW personal 12/13/94 12/13/94 R115254 Sip5 RW Sip5 Sip005 synaptotagmin interacting protein 3 One of a class of serine/threonine protein kinases that contain a common C-domain that binds to Syt4. Isolated using the two-hybrid method (LEX-Syt4 fusion protein as bait). Probably involved in synaptic vesicle movement. A homolog of the C. elegans Unc51 gene. Morgan JI 1994 personal communication 1994 RW personal 12/13/94 12/13/94 R115255 Slc1a4 RW slc1a4, asct1 Slc001a004 neutral amino acid transporter, sodium-dependent SLC1A4, ALCT1 2p15-p13 A human gene that probably has a mouse homolog. Transports alanine, serine, systeine, and threonine. Hofmann K 1994 Genomics 24:20 1994 RW personal 11/29/94 11/29/94 R115231 Slc2c RW slc2c, ae3 Slc002c solute carrier type 2, member C / anion exchanger 3 SLC2C 2q36-q36 A chloride-bicarbonate ion exchanger involved in pH regulation, chloride ion concentration, and cell volume. Mouse homolog may map to Chr 2 at about 37 cM or Chr 1 at about 52 cM. Compare to D11Mit52, an SSLP from a GenBank Ae3 sequence. Su YR 1994 Genomics 22:605 1994 RW personal 9/11/94 10/17/94 R114053 Sod3 RW sod3 Sod003 superoxide dismutase 3, extracellular Hom SOD3 4p16.3-q21 Catalyzes the conversion of superoxide anion radicals to hydrogen peroxide and molecular oxygen. SOD3 is the major extracellular family member. Forms a homotetramer of 135 kDa. Binds heparin glycosaminoglycan. Mapped in human and cow. Possible mouse homolog. Chr 5 is a good candidate. 6 1.15.1.1 RW personal 8/10/94 9/21/94 R111732 Sodcz RW sodcz Sodcz superoxide dismutase, copper and zinc Bewley G 1988 Nucleic Acids Res 16:2728 M35725, X06683, X02317 (Hsa) mRNA complete cds D 1988 RW personal 8/10/94 9/10/94 R111329 Sodmn RW sodmn Sodmn superoxide dismutase, manganese Hallewell R 1986 Nucleic Acids Res 14:9539 X04972, Y00985 (Hsa) D 1986 RW personal 8/10/94 9/10/94 R111330 Spat RW spat Spat serine-pyruvate aminotransferase Mapped in rat to Chr 9q34-q36. Reserved provisionally by RW. Check with GBASE. Mori 1992 Genomics 13:686 9q34-q36 (SPAT) 1993 RW personal 8/10/94 R111331 Spr RW spr, nk2r Spr substance P receptor / neurokinin A receptor Mapped in rat to Chr 4. Contains a polymorphic microsatellite in rat amplified by R15 PCR primer set. This primer set is not yet known to be polymorphic in mouse. Kondo Y 1993 Mammalian Genome 4:571 4 M31838 (Rno), M57414 (Hsa) P protein (receptor) Rat R15 PCR primers, Kondo Y 1993. Not polymorphic in mouse 1993 RW personal 8/10/94 9/1/94 R111332 Ssa2 RW ssa2 Ssa002 SS-A/Ro ribonucleoprotein autoantigen SSA2 1q31-q31 60 kDa SS-A/Ro ribonucleoprotein autoantigen. A human gene that may have a mouse homolog. Chan EKL 1994 Genomics 23:298 1994 RW personal 9/18/94 10/7/94 R114087 Sspp RW sspp Sspp synapse specific phosphoprotein F1-20 Lafer E 1991 J Neurosci 12:2144 M83985 mRNA sequence. D 1992 RW personal 8/10/94 R111333 Stat1 RW p91 stat1, p91 Stat001 signal transducer and activator of transcription 1 STAT1 91 kDa termed alpha, 84 kDa form is beta. Dimerize with Stat2 to form transcription factor ISGF3alpha. Transcription activator in the interferon and cytokine receptor superfamily. Zhong Z 1994 Science 264:95 & Ihle JN 1993 personal communication U06924 About 90% homologous at nucleotide level with human STAT1. D 1994 RW personal 8/10/94 5/30/94 R111334 Stat2 RW p113 stat2, p113 Stat002 signal transducer and activator of transcription 2 Stat2 is a 113 kDa protein. p91 and p113 are homologs that dimerize to form transcription factor ISGF3a. Important transcription activator in the interferon and cytokine receptor superfamily. Zhong Z 1994 Science 264:95 & Ihle JN 1993 personal communication D 1994 RW personal 8/10/94 5/30/94 R111335 Stat3 RW stat3 Stat003 signal transducer and activator of transcription 3 92 kDa. Signal transduction and transcription activator.Stat3 activated by phosphorylation on tyrosine in response to EGF and IL6, but not to IFNgamma. Zhong Z 1994 Science 264:95 U06922 About 40-50% aa homology to mouse Stat1 and Stat2. D 1994 RW personal 8/10/94 5/30/94 R111336 Stat4 RW stat4 Stat004 signal transducer and activator of transcription 4 Important transcription activator in the interferon and cytokine receptor superfamily. Substrate of Jak1 and Jak2. Expressed only prior to globin synthesis in the RBC lineage. Zhong Z 1994 Science 264:95 U06923 D 1994 RW personal 8/10/94 5/30/94 R111337 Sthm RW sthm, p18 Sthm stathmin p18 Symbol is just a temporary placeholder. Get proper symbol from GDB. J04979 (Rno), J04991 (Hsa) 1994 RW personal 9/7/94 9/7/94 R113983 Stms RW stms, stm Stms sulfotransferase, phenol preferring, temperature sensitive STM 16p11.2-p11.2 Symbol should ideally be Stm in the mouse. However, this symbol used for an unmapped mouse mutation, stumpy. Aksoy IA 1994 Genomics 23:275 2.8.2.9 No recombination with D7Bir1 1993 RW personal, nomenclature 9/18/94 9/18/94 R114084 Strm2 RW strm2 Strm002 stromelysin 2 Symbol is just a placeholder. Use GDB nomenclature, if available. X02601 (Rno), X07820 (Hsa) 1994 RW personal 9/10/94 9/10/94 R114002 Sugp2 RW sugp2, sgp2 supg002 sulfated glycoprotein 2 Symbol is just a temporary placeholder. Get proper symbol from GDB. M16975 (Rno), M25915 (Hsa) 1994 RW personal 9/10/94 9/10/94 R114003 Svpf RW svpf Svpf seminal vesicle F protein Mouse gene listed in GenBank Entrez Release 9. Get additional information when published. Coleman RT 1991 unpublished X57139 638 linear mRNA sequence. 1994 RW personal 8/10/94 10/17/94 R111770 Svs2p RW svs2p Svs002p seminal vesicle secretion protein 2p Putative homolog of rat SVS2P locus. Maps to rat Chr 3. Not in GBASE. Symbol taken from rat by RW. Kondo Y 1993 Mammalian Genome 4:571 3 (SVS2P) P 1993 RW personal 8/10/94 3/27/94 R111338 Synx RW synx Synx synexin Annexin 7 or annexin VII. Zhang-Keck Z 1993 Biochem J 289:736 L13129 mRNA, complete cds. D 1993 RW personal 8/10/94 R111339 Syt4 RW syt4 Syt004 synaptotagmin 4 A gene product involved in the calcium mediated release of neurotransmitters from synpatic vesicles. This is JI Morgan's Syt4, not that of Meisler M. Morgan's Syt4 is much more divergent that the other Syt genes and is more widely expressed in brain. Hilbush BS 1994 PNAS 91:8195 U10355 3992 bp mRNA sequence. Get map data from M Meisler. 1994 RW personal, nomenclature 9/1/94 12/15/94 R113979 Syt5 RW Syt4 syt4, syt5 Syt005 synaptotagmin 5 This locus from Meisler M (Nov 1994 personal communication) is probably not the same as the Syt4 of Morgan JI (Dec 1994 personal communication). Meisler M 1994 personal communication U10355 3992 bp mRNA sequence. Get map data from M Meisler. 1994 RW personal, nomenclature 12/15/94 12/15/94 R115263 Tabs RW tabs Tabs T protein DNA binding site A high affinity DNA binding site of the large T protein of polyoma virus. Galup C 1987 Biochem Biophys Res Comm 148:1053 M18113 D 1987 RW personal 8/10/94 R111340 Tana RW tana Tana tanabin Tanabin is expressed at high levels in the hindbrain of Xenopus. May be involved in regional, axial differentiation of the CNS. Hemmati-Brivanlou A 1992 Nature 359:609 1994 RW personal 8/20/94 8/20/94 R113788 Tax1 RW Tag1 tax1, tag1 Tax001 transient axonal glycoprotein 1 Hom TAX1 1q32 A cell adhesion molecule that promotes axon outgrowth. Member of immunoglobulin superfamily. Known as axonin 1 in the chick. IgC2 domains and fibronectin repeats in all species. RGD tripeptide motif may mediate recognition of fibronectin. Tsiotra PC 1993 Genomics 18:562 TAX1 D Human TAX1 PCR primers: GGATCCCAGGGCTGAACTCCAAGC, CAAAGACAGGCCCCGAAGGTGG 1994 RW personal 8/10/94 9/19/94 R111556 Tbp RW tbp, tfiid Tbp TATA box binding protein / basal transcription factor TFIID subunit TBP 6q27-q27 A protein necessary for transcription of class I,II, and III genes. It is the DNA binding subunit of TFIID and a component of SL1 and TFIIIB. Interacts with p53. Has a saddle-like strucutre that straddles the TATA box. Has a glutamine rich segment (34 consecutive residues) similar to those of Sp1, zeste, notch, antennapedia, bithorax, cuticle and fushi-tarazu. Purrello M 1994 Genomics 22:94 1994 RW personal 9/18/94 1/22/95 R114102 Tcf11 RW tcf11 Tcf011 transcription factor 11, bZIP family member 17q22 A widely expressed basic leucine zipper class transcription factor very similar to the globin locus control region binding protein NF-E2, p45. mapped in human. May have a mouse homolog. Luna L 1994 Genomics 22:553 1994 RW personal 9/11/94 10/7/94 R114052 Tcfear2 RW MUSEAR2TFA Tcfear2 Tcfear002 transcription factor, ear 2 GenBank entry of Aug 4, 1994. L25674 L25674: 1643 bp mRNA sequence. 1994 RW personal 8/9/94 8/9/94 R113769 Tcp1-L1 RW tcp1l1 Tcp001L001 t complex 1-like 1 Hom TCP1L1 7p14-cen Mapped in human and rat. May have a mouse homolog, perhaps on Chr 2, 5, or 6. 4 1994 RW personal 8/10/94 10/17/94 R111748 Tcpe RW MUSSTCPE tcpe tcpe T cell secreted protein P600 Symbol taken from GenBank. An inducible inflammatory protein secreted by T cells. Brown KD 1989 J Immunol 142:679 M23504 M23504: mRNA sequence of 1207 bp 1989 RW personal 9/10/94 9/10/94 R114023 Tef1 RW tef1, mtef1 Tef001 transcription enhancer factor Homolog of the human TEF1 locus. A ubiquitous factor. The protein binds to the M-CAT motif of the myosin heavy chain beta gene. Xiao J 1991 Cell 65:551 & Blatt C 1993 Nucleic Acids Res 21:747 L06865, L13853 mRNA sequence D 1991 RW personal 8/10/94 5/22/94 R111341 Teg261 RW teg, teg261 Teg261 TEG gene 261 Lopez-Fernandez LA 1994 unpublished X81058 1398 bp mRNA sequence 1994 RW personal, nomenclature 9/1/94 9/1/94 R113974 Teg271 RW teg, teg271 Teg271 TEG gene 271 Lopez-Fernandez LA 1994 unpublished X81059 959 bp mRNA sequence 1994 RW personal, nomenclature 9/1/94 9/1/94 R113975 Tel RW tel, cmml, aml, mds Tel translocation, Ets, leukemia Hom TEL 12p13 An ets like gene associated with chronic myelomonocytic leukemia in humans. May have a mouse homolog. Golub TR 1994 Cell 77:307 1994 RW personal, nomenclature 8/20/94 10/7/94 R113793 TeraE2 RW terae2, 'e2' TeraE002 teratocarcinoma E2 Reichel R 1987 Cell 48:501 M15109 Sequence of the promoter region of E2 gene. D 1993 RW personal 8/10/94 R111342 Tg110C RW tg110c, 110c Tg0110c 5Õ flank of transgene 110C Minisatellite transgene. X78698, X78699 X78698: 296 bp of genomic DNA 5Õ of a transgene & X78699: 537 bp 3Õ to minisatellite transgene 1994 RW personal 8/8/94 8/8/94 R113763 Tg110D RW tg110d, 110d Tg0110d 5Õ flank of transgene 110D Minisatellite transgene. X78701 X78701: 255 bp of genomic DNA 5Õ of a transgene. 1994 RW personal 8/8/94 8/8/94 R113762 Tgm1 RW TGase tgm1, tgase Tgm001 transglutaminase 1 M55154, M55153 (Hsa) 1994 RW personal 9/10/94 9/10/94 R114007 Tgpt4 RW tgpt4 Tgpt004 T cell glycoprotein T4 X04836, M12807 (Hsa) 1994 RW personal 9/10/94 9/10/94 R114004 Thbxs RW thbx Thbxs thromboxane synthase Zhang L 1993 Biochem Biophys Res Comm 194:741 L18868 mRNA sequence. D 1993 RW personal 8/10/94 R111344 Thro RW thro, throa Thro thrombopoietin Stimulates platelet production. Provisional symbol taken from GBASE mnemonic. Lok S 1994 Nature 369:565 L34169 1486 bp ss-mRNA sequence. 1994 RW personal 8/10/94 8/1/94 R113633 Tiam1 RW tiam1 tiam001 invasion inducing gene, Tiam1 Encodes a protein with homology to GDP-GTP exchangers for Rho-like proteins. Habets GGM 1994 Cell 77:537 U05245 7292 bp mRNA sequence 1994 RW personal 8/6/94 8/6/94 R113757 Tilp RW tilp Tilp trypsin inhibitor like protein Defined in rat by a polymorphic microsatellite. Not in GBASE. Located about 16 cM distal to transthyretin TTR locus. Remmers EF 1993 Mammalian Genome 4:265 18 (TILP) M35299 (Rno) D Rat PCR primers F=GTTATGGATGCAAGATGGCTCC, R=GGAAGGTGAAACTTTAGAAACG, product of about 600 bp 1993 RW personal 8/10/94 8/20/94 R111345 Tis21 RW tis21 Tis021 tetradecanoyl phorbol ester induced sequence 21 A 17 kDa primary response gene induced by growth factors and tumor promoters. Fletcher B 1992 J Bio Chem 267:4338 M64292 dsDNA complete cds. Single intron of 1.4 kb. 5'-flanking sequence contains TATA and CAAT box-type sequences and 3 possible Sp1 sites, AP1 and AP2 and cAMP response elements. Contains microsatellite of 29 CA rep D 1992 RW personal, duplicate? 8/10/94 R111347 Tis7 RW tis7, pc4 Tis007 tetradecanoyl phorbol ester induced sequence 7 Unlike Tis11, the expression of Tis7 is not elevated in motorneurons following axotomy. Varnum B 1989 Oncogene 4:1263 X17400 mRNA sequence. D 1989 RW personal 8/10/94 R111346 Tkp56 RW tkp56 Tkp56 tyrosine kinase, p56-tck May be a duplicate. May not be a gene. Expression of this tyrosine kinase stimulated by a retroviral promoter insertion by Voronova A et al 1986. Voronova A 1986 Nature 319:682 X03533 D 1986 RW personal 8/10/94 R111348 Tktc RW Tsk Tktc, tsk Tktc tyrosine kinase, T cell specific May be a duplicate. Provisional symbol. Check Lck and related loci. Heyeck S 1993 PNAS 90:669 L05631 D 1993 RW personal 8/10/94 R111349 Tln RW tln Tln talin Cytoplasmic membrane-associated protein. Binds to integrin beta 1 subunit cytoplasmic domain and to vinculin. Rees D 1990 Nature 347:685 X56123 protein (membrane) 1993 RW personal 8/10/94 R111350 Tmb10 RW T beta 10 tmb10 Tmb010 thymosin beta 10 A retinoic acid responsive gene with developmental regulated and very strong expression in mammalian brain. Not expressed in adult except in olfactory receptor neurons and following axon damage. A G-actin binding protein. Condon MR 1992 J Mol Neurosci 3:165 RW personal 8/10/94 12/13/94 R111352 Tmb4 RW T beta 4 tmb4, tbeta4 Tmb004 thymosin beta 4 A 5 kDa G-actin sequestering peptide. Inhibit polymerisation of F-actin. Down-regulation of its expression correlated with metastatic capacity of colorectal carcinomas. Developmentally regulated in brain. 8 other thymosin beta proteins. Rudin C 1990 J Immunol 144:4857 & Yamamoto T 1993 Biochem Biophys Res Comm 193:706 M54991, X16053 dsDNA and mRNA sequences. D 1990 RW personal 8/10/94 R111351 Tmp5 RW tmp5 Tmp005 tropomyosin 5, nonmuscle Takenaga K 1990 Biochimica Biophysica Acta 1087:101 X53753 D 1990 RW personal 8/10/94 R111354 Tpia2 RW tpia2 tpia002 thiol proteinase inhibitor alpha 2 Symbol is just a temporary placeholder. Get proper symbol from GDB. M11883(Rno), K02566 (Hsa) 1994 RW personal 9/10/94 9/10/94 R114005 Tptc RW tptc Tptc translationally controlled tumor protein Symbol is just a temporary placeholder. Get proper symbol from GDB. X06407, X16064 (Hsa) 1994 RW personal 9/10/94 9/10/94 R114008 Traf1 RW traf1 Traf001 tumor necrosis factor receptor associated factor 1 A putative signal transducer associated with the cytoplasmic domain of the 75 kDa tumor necrosis factor receptor. Rothe M 1994 Cell 00:000 L35302 1994 RW personal 9/1/94 9/1/94 R113971 Trala RW Tra, Ala-tRNA trala, alatra, tra Trala transfer RNA alanine Russo T 1986 Eur J Biochem 158:437 M26847, Y00460 D DNA (tRNA) 1986 RW personal 8/10/94 R111355 Trap815a RW trap815a Trap815a tumor rejection antigen P815A A major tumor rejection antigen. Van B 1991 J Exp Med 173:1373 M36386, M36387 dsDNA and mRNA sequence. D 1991 RW personal 8/10/94 R111356 Trarg1 RW Trr1, Arg-tRNA trarg, trr1, argtrna Trarg001 transfer RNA arginine 1 Harada F 1980 Biochem Inter 1:539 K00162 D DNA (tRNA) 1980 RW personal 8/10/94 R111357 Trarg2 RW Trr2, Arg-tRNA trarg, trr2, argtrna Trarg002 transfer RNA arginine 2 Harada F 1980 Biochem Inter 1:539 K00163 D DNA (tRNA) 1980 RW personal 8/10/94 R111358 Trasp RW Trn, Asp-tRNA, tRNAAsp Trasp, asptrna, trnaasp, trn Trasp transfer RNA aspartate GAU(C) anticodon (?). Russo T 1986 Eur J Biochem 158:437 & Ronney R 1988 Nucleic Acids Res 16:2509 X07460, M26850 D DNA (tRNA) 1986 RW personal 8/10/94 R111359 Trgly RW Trg, Gly-tRNA, tRNAgly trgly, glytrna, trnagly, trg Trgly transfer RNA glycine GGA(G) Russo T 1986 Eur J Biochem 158:437 M26850, M12256, X01593 D DNA (tRNA) 1986 RW personal 8/10/94 R111360 Tric5 RW mTRiC-P5 tric5 Tric005 TCP1 ring complex 5 TRIC5 1q23-q23 A molecular chaperone involved in the production of actin and tubulin. Surprisingly, TRIC5 is not syntenic with TCP1 in human. May not be located on MMU Chr 17. Sevigny G 1994 Genomics 22:634 1994 9/11/94 10/17/94 R114055 Trile RW Tri, tRNAile, Ile-tRNA trile, trnaile, iletrna Trile transfer RNA isoleucine Russo T 1987 Nucleic Acids Res 15:8562 Y00460 D DNA (tRNA) 1987 RW personal 8/10/94 R111361 Trm4 RW Met-tRNA trm4, mettrna, trnamet Trm004 transfer RNA methionine 4, elongation Piper P 1975 Eur J Biochem 51:283 & Piper P 1978 Nucleic Acids Res 5:4761 M25088, K00329 D DNA (tRNA) 1975 RW personal 8/10/94 R111362 Trp-ps1 RW trpps1 Trpps001 transfer RNA proline, pseudogene 1 tPro51 of Russo T 1986. This expressed gene contains several mutation and deletions that probably prevent the formation of a cloverleaf structure. Russo T 1986 Eur J Biochem 158:437 M26851 D DNA (tRNA) 1986 RW personal 8/10/94 R111365 Trphe RW Trf, Phe-tRNA, tRNAphe trphe, trf, phetrna, trnaphe Trphe transfer RNA phenylalanine DNA (tRNA) RW personal 8/10/94 8/8/94 R111363 Trphe-ps1 RW Trf-ps1 trpheps1, trfps1 Trpheps1 ransfer RNA, phenylalanine, pseudogene 1 Reilly J 1982 Nature 300:287 M24167 D DNA (tRNA) 1992 RW personal 8/10/94 3/27/94 R111364 Trpr RW Trpr Trpr transmembrane protein Title of accession is ÒCloning and characterization of a novel gene with a potential transmembrane domain. Symbol adapted from GenBank mnemonic. Hong G 1994 unpublished L34260 3094 bp ss-mRNA sequence. 1994 RW personal, nomenclature 8/10/94 8/1/94 R113631 Trq2 RW Trq-2, Gln-tRNA, tRNAgln trq2, glntrna, trgln, trnagln Trq001 transfer RNA glutamine 2 CTC codon. In the rat this tRNA found in a cluster with Asp-tRNA(GAU) and Gly-tRNA(GGA). See Sekiya T 1981 Nucleic Acids Res 9:2239. DNA (tRNA) RW personal 8/10/94 8/8/94 R111366 Trthr RW Thr-tRNA trthr, thrtrna Trthr transfer RNA threonine NGU. Harada F 1989 Nucleic Acids Res 17:7517 X15812 D DNA (tRNA) 1989 RW personal 8/10/94 R111367 Trtrp RW Trw, Trp-tRNA, tRNAtrp trtrp, trptrna, trnatrp, Trw Trtrp transfer RNA tryptophan DNA (tRNA) RW personal 8/10/94 8/8/94 R111368 Trtrp-ps1 RW Trw-ps1 trtrpps1, trwps1 Trtrpps001 transfer RNA tryptophan, pseudogene 1 Identical to the 3' half of a tRNA of chicken, but has two point mutations and three base deletions that prevent the folding of the transcript. Ammendola R 1988 Ital J Biochem 37:85 D DNA (tRNA) 1988 RW personal 8/10/94 R111369 Trval RW Trv, Val-tRNA trval, trv Trval tRNA valine Piper P 1975 Eur J Biochem 51:295 K00251, K00252 D 1975 RW reserved 8/10/94 R111370 Tsg31x RW tsg31x Tsg031x expressed sequence tag Tsg31x Isolated by a differential cDNA library screening procedure. Hoog C 1991 Nucleic Acids Res 19:6123 X61855 mRNA partial sequence. D 1991 RW personal 8/10/94 R111371 Tsn RW tsn Tsn tensin Cytoplasmic membrane-associated protein. Binds actin. Has SH2 domain, a motif that binds phosphorylated tyrosines. protein (membrane) 1993 RW personal 8/10/94 R111372 Ttp RW ttp Ttp tristetraproline A proline-rich protein gene induced by insulin. Symbol assigned by Lai W (1990). Check relationship to other proline-rich protein loci. Lai W 1990 J Bio Chem 265:16556 M57422 mRNA sequence, complete cds. D 1990 RW personal 8/10/94 R111373 Ttrebp RW MUSALB1 ttre Ttrebp transthyretin enhancer binding protein Provisionally reserved by R Williams on the basis of sequence and function data of Costa. Check with GBASE. Costa R 1988 PNAS 85:3840 M19523 transthyretin (prealbumin) enhancer. *Title* A liver-specific DNA-binding protein recognizes multiple nucleotide sites in regulatory regions of transthyretin, alpha-1-antitrypsin, albumin, and simian virus 4 D DNA (binding protein) 1988 RW personal 8/10/94 R111374 Tuba2 RW tuba2 Tuba002 tubulin, alpha 2 Lewis S 1985 J Cell Bio 101:852 M28727 3' gene end' D 1985 RW personal 8/10/94 R111375 Tubb2 RW tubb2 Tubb002 tubulin, beta 2 Lewis S 1985 J Cell Bio 101:852 M28739 3' gene end' D 1985 RW personal 8/10/94 R111376 Tubb4 RW tubb4 Tubb004 tubulin, beta 4 Lewis S 1985 J Cell Bio 101:852 M28730 3' gene end' D 1985 RW personal 8/10/94 R111377 Tubb5 RW tubb5 Tubb005 tubulin, beta 5 Lewis S 1985 J Cell Bio 101:852 M28732 3' gene end' D 1985 RW personal 8/10/94 R111378 Tyk2 RW tyk2 Tyk002 TYK2 protein tyrosine kinase 2 Important intermediary in the cytokine and interferon signalling pathways. Ihle JN 1994 personal communication D 1993 RW personal 8/10/94 R111379 Ugt1.6 RW ugt16 Ugt001.006 uridine diphosphate glucuronosyltransferase 1.6 Differential induction of this gene by tetrachlorodibenzo-p-dioxin. Lamb JG 1994 Biochem 000:000 U09930 1634 bp mRNA sequence. 1994 RW personal, nomenclature 8/10/94 8/1/94 R113634 Umps RW umps Umps uridine monphosphate synthetase / orotate phosphoribosyl transferase / orotidine-5-5-decarboxylase Hom UMPS 3q21 Mapped in human, cow, sheep, and hamster. Mouse homolog may map to Chr 9. 1q31 4p 19 1994 RW personal 8/10/94 8/18/94 R111728 Uqcrc2 RW uqcrc2 uqcrc002 mitochondrial cytochrome bc1, core protein 2 subunit Hom UQCRC2 16p12 A human gene that may have a mouse homolog. Duncan AM 1993 Genomics 18:455 1993 RW personal 8/10/94 8/18/94 R111557 Urn RW urn Urn uromodulin Tamm-Horsfall glycoprotein. Symbol is just a temporary placeholder. Get proper symbol from GDB. M63510 (Rno), M15881 (Hsa) 1994 RW personal 9/10/94 9/10/94 R114010 Ut2 RW ut2 ut002 urea transporter 2 A rabbit gene that may have a mouse homolog. The transporter protein is regulated by vasopressin. Cloned and characterized by You G et al 1993. Expressed in renal papillary tip, inner and outer medulla, colon, liver, and lung. You G 1993 Nature 365:844 In rabbitt an open reading frame of 1191 bp, a 397 aa protein, with 10 putative transmembrane domains, a single potential extracellular N-glycosylation site, 3 intracellular phosphorylation sites. 1994 RW personal 8/10/94 3/24/94 R111607 Vdbp RW vdbp Vdbp vitamin D binding protein Symbol is just a temporary placeholder. Get proper symbol from GDB. M12450 (Rno), M12654 (Hsa) 1994 RW personal 9/10/94 9/10/94 R114011 Vdr RW vdr Vdr vitamin D receptor Vitamin D receptor is not the same as the binding protein "Group-specific component" on Chr 5. The receptor maps in rat to Chr 7. Symbol reserved provisionally by RW. Check with GBASE. 7 (VDR) J04147 (Rno), J03258, (Hsa) RW personal 8/10/94 9/10/94 R111382 Vg1 RW vg1 Vg001 vegetal 1 A vegetal pole egg protein characterized in Xenopus that may be involved in dorsal-ventral axis determination and mesoderm induction. May have a mammalian homolog. Vize PD 1994 Trends Genet 10:371 1994 RW personal 12/14/94 12/14/94 R115260 Vhl RW vhl Vhl von Hippel-Lindau tumor suppressor VHL The mouse homolog of the von Hippel-Lindau tumor suppressor gene has been sequenced and mapped. Data not yet available. Latif F 1994 Unpublished U12570 U12570: 1384 bp mRNA sequence. According to GenBank note, the chromosomal location of this gene is known in mouse. 1994 RW personal 8/9/94 8/9/94 R113768 Wars RW wars Wars tryptophanyl tRNA synthetase WARS 14q24 Reserved by RW provisionally. Graphodatsky A 1993 Mammalian Genome 4:183 3 7q24-q26 6.1.1.2 1993 RW personal 8/10/94 3/27/94 R111383 Wrn RW wrn, 'ws' Wrn Werner syndrome WRN 8p12 A human autosomal recessive disorder locus associated with premature aging. May have a mouse homolog. Nakura J 1994 Genomics 23:600 1994 10/29/94 11/10/94 R114375 Xash3 RW xash3 Xash003 xenopus ascheate schute homolog 3 A vertebrate homolog of the Drosophila acheate-schute gene. It is involved in early neural induction. Zimmerman K 1993 Development 119:221 1993 RW personal 8/20/94 8/20/94 R113790 Xbp RW Crebp2?, Creb2, mXBP xbp, mxbp, crebp2, creb2 Xbp X binding protein May be related or the same as cAMP responsive element-binding protein 2. Forms a complex with c-jun that binds to cyclic AMP response elements. Ivashkiv L 1990 Mol Cell Biol 10:1609 M31629 D protein (binding) 1990 RW personal 8/10/94 R111384 Xlhbox6 RW xlhbox6 Xlhbox006 xenopus laevis homeobox 6 Expressed early in the spinal cord of Xenopus. May have a mammalian and murine homolog. Wright CVE 1990 Development 109:225 1990 RW personal 8/20/94 10/7/94 R113791 Xrcc5 RW Xrcc-5 xrcc5 Xrcc005 X-ray repair 5 L XRCC5 2q35 Human gene may have mouse homolog. Chen DJ 1994 Genomics 21:423 9 B D RW personal 8/10/94 10/7/94 R111981 Zap70 RW zap70 Zap070 Zap70 kinase ZAP70 A kinase critical in CD8 positive T cell development. Human gene may have mouse homolog. Mutation in gene in human responsible for lack of CD8 T cells. Associated with severe immunodeficiency. Arpaia E 1994 Cell 76:947 Human PCR primers in Arpaia ref. 1994 RW personal 8/10/94 3/24/94 R111701 Znf25 RW znf25, kox19 Znf025 zinc finger protein 25 ZNF25 10p11.2-p11.2 Part of the A cluster of zinc finger genes, along with ZNF11A, ZNF33A, and ZNF37A. Huebner K 1991 Am J Hum Genet 48:726 & Tunnacliffe A 1993 Nucleic Acids Res 21:1409 18 X52350 (Hsa) The A cluster maps to human 10p11.2 while the B cluster (ZNF11B, ZNF33B, and ZNF37B) map to 10q11.2. Mouse locus might map to proximal Chr 18. 1991 RW personal 9/18/94 9/19/94 R114099 Znf83 RW znf83 Znf083 zinc finger 83 Hom ZNF83 19q13.3-q13.4 This human gene may have a mouse homolog on Chr 7. Marine JC 1994 Genomics 21:285 1994 8/10/94 10/7/94 R113650 ZZZ1 RW dxs1269e zzz DNA segment, human DXS1269E, single copy, expressed DXS1269E Xq21.3-Xq22 A gene located within 100 kb of the BTK gene in humans. Vorechovsky I 1994 Genomics 21:517 L20773 (Hsa) 1994 8/10/94 10/17/94 R113622 ZZZ2 RW dxs1271e zzz DNA segment, human DXS1271E, single copy, expressed DXS1271E Xq21.3-Xq22 A gene located within 100 kb of the BTK gene in humans. Vorechovsky I 1994 Genomics 21:517 UO1923 (Hsa) 1994 8/10/94 10/17/94 R113363 ZZZ3 RW dxs1273e zzz DNA segment, human DXS1273E, single copy, expressed DXS1273E Xq21.3-Xq22 A gene located within 100 kb of the BTK gene in humans. Vorechovsky I 1994 Genomics 21:517 UO1925 (Hsa) 1994 8/10/94 10/17/94 R113364 ZZZ4 RW dxs1274e zzz DNA segment, human DXS1274E, single copy, expressed DXS1274E Xq21.3-Xq22 A gene located within 100 kb of the BTK gene in humans. Vorechovsky I 1994 Genomics 21:517 UO1925 (Hsa) 1994 8/10/94 10/17/94 R113365 ZZZ5 RW hfk1, bf1 zzz.hfk001 fork head homolog 1 Hom HFK1 14q11-q13 May map to mouse chr 14 based on homology to human gene. A fork head gene family member. In situ in mouse embryo shows strong hybridization in cells migrating into cortex and hippocampus, but not in thalamus or cerebellum. Related to rat brain factor 1 gene. In human there are also HFK2 and HFK3 genes. Li J 1992 Genomics 13:665 & Murphy DB 1994 Genomics 21:551 1994 human, RW personal 8/10/94 10/17/94 R113371 ZZZ6 RW ilf zzz.ilf interleukin binding factor ILF 17q25 A human gene and a fork head gene family member. No data on mouse homolog, if any. Binds to the long terminal repeats of HIV and HTLV. Li J 1991 PNAS 88:7739 1994 human 8/10/94 10/17/94 R113370 ZZZ7 RW xk, kell zzz.xk Kell x antigen / McLeod syndrome XK Xp21 A low abundance 37 kDa erythrocyte protein. McLeod syndrome characterized by aberrant Kell blood group antigens, absent Kx antigen. Late onset dystonia. Some similarities to HuntingtonÕs disease. Single membrane-spanning protein with large extracellular domain. Ho M 1994 Cell 77:869 Z32684 (Hsa) 1994 RW personal 8/10/94 10/17/94 R113624 SOURCES: Sym_mouse: data taken primarily from Mouse Genome 91:156-299. Updated using GBASE Locus List November 1993. Hypens deleted as per agreement at 1993 Nomenclature Meeting. Chr_mouse Alias: Several sources, most prominently GBASE, Nov 1993 listing. Search_sym: Portable Dictionary of the Mouse Genome. Sort_by_mouse_sym: RW Map_ccr: Mostly data taken directly from the Mouse Chromosome Committee Reports. In some cases, values have been assigned by RW for new MIT SSLP loci following the Committee intervals. Map_mit: cM distances of MIT loci relative to most proximal MIT locus. Whitehead Institute/MIT Center for Genome Research, Genetic Map of the Mouse, Database Release 5 of January 1994. Data were corrected to el Chr_band: In mouse Locus_name: Locus names from various sources, most prominently, GBASE. Use of hypens in names has been minimized to simplify searching. Hypens are retained in biochemical names, but not in loci such as "crinkly-tail." Method: data from Genetic Maps: Locus Maps of Complex Genomes 6th ed 1993. SJ O'Brien ed pp. 4.53 to 4.109. Sym_human: from Genetic Maps 6th ed Book 5 Chr_human: Chromosomal position of human homolog of mouse locus. From GDB or primary literature. Chr_hs_guess: Position of homologous human gene or position of nearby loci that do have human homologs. Comment: Paraphrased information from many sources. Reference: from various sources, most prominently, the Chromosome Committee Reports Ref_ccr: 1993 Chromosome Committee Report reference numbers published in the special issue of Mammalian Genome 4, late 1993. Most of these reports were prepared in the spring of 1993. Anchor_comp: OÕBrien et al., 1994, Report of the Committee on Comparative Gene Mapping HGM 93 Chr_cat: from S.J. O'Brien, Genetic Maps 6th ed 1993 Chr_cow: Womack JE (1993) Genetic Maps 6th ed, book 4, p 4.264-4.275. OÕBrien et al., 1994, Report of the COmmittee on Comparative Gene Mapping HGM 93 Chr_deermus: deermouse data from OÕBrien et al., 1994, Report of the Committee on Comparative Gene Mapping HGM 93 Chr_dog: OÕBrien et al., 1994, Report of the COmmittee on Comparative Gene Mapping HGM 93 Chr_fox: OÕBrien et al., 1994, Report of the Committee on Comparative Gene Mapping HGM 93 Chr_hamster: OÕBrien et al., 1994, Report of the Committee on Comparative Gene Mapping HGM 93 Chr_horse: OÕBrien et al., 1994, Report of the Committee on Comparative Gene Mapping HGM 93 Chr_mink: OÕBrien et al., 1994, Report of the Committee on Comparative Gene Mapping HGM 93 Chr_mouse_predicted: Chr_pig: OÕBrien et al., 1994, Report of the Committee on Comparative Gene Mapping HGM 93 Chr_rabbit: OÕBrien et al., 1994, Report of the Committee on Comparative Gene Mapping HGM 93 Chr_rat: Levan G 1993 Genetic Maps 6th ed. Book 4, p. 4.193-4.206. Data are current to July 1992. Chr_sheep: OÕBrien et al., 1994, Report of the Committee on Comparative Gene Mapping HGM 93 Comp_note: Cosmid_hsa: Cosmid_mmu: Enzyme: Various sources Genbank: Gifford Keen, Los Alamos National Laboratory provide a listing of data on all mouse sequence files in GenBank up to Aug 1993. This file is available from RW on request. Gene_note: usually from GenBank Is_129: Genetic Variants and Strains of the Laboratory Mouse, 2nd ed Chpt 17 by Roderick & Guidi. Carret^ indicates within-strain variability. Asterisk is a blank "placeholder". Is_a: Genetic Variants and Strains of the Laboratory Mouse, 2nd ed Chpt 17 by Roderick & Guidi. Carret^ indicates within-strain variability. Asterisk is a blank "placeholder". Is_akr: Genetic Variants and Strains of the Laboratory Mouse, 2nd ed Chpt 17 by Roderick & Guidi. Carret^ indicates within-strain variability. Asterisk is a blank "placeholder". Is_balbc: Genetic Variants and Strains of the Laboratory Mouse, 2nd ed Chpt 17 by Roderick & Guidi. Carret^ indicates within-strain variability. Asterisk is a blank "placeholder". Is_c3h: Genetic Variants and Strains of the Laboratory Mouse, 2nd ed Chpt 17 by Roderick & Guidi. Carret^ indicates within-strain variability. Asterisk is a blank "placeholder". Is_c57bl6: Genetic Variants and Strains of the Laboratory Mouse, 2nd ed Chpt 17 by Roderick & Guidi. Carret^ indicates within-strain variability. Asterisk is a blank "placeholder". Is_dba2: Genetic Variants and Strains of the Laboratory Mouse, 2nd ed Chpt 17 by Roderick & Guidi. Carret^ indicates within-strain variability. Asterisk is a blank "placeholder". Is_sjl: Genetic Variants and Strains of the Laboratory Mouse, 2nd ed Chpt 17 by Roderick & Guidi. Carret^ indicates within-strain variability. Asterisk is a blank "placeholder". Type: data from Genetic Maps: Locus Maps of Complex Genomes 6th ed 1993. SJ O'Brien ed pp. 4.53 to 4.109. Map_gbase Map_cm_hsa: Map_mb_hsa: Flpter_hsa: Map_note: from primary literature. Mit_panel: Dietrich et al April 1994 release Mit_a: Dietrich et al April 1994 release Mit_akr: Dietrich et al April 1994 release Mit_assay: Dietrich et al April 1994 release Mit_c57bl6: Dietrich et al April 1994 release Mit_balbc: Dietrich et al April 1994 release Mit_c3h: Dietrich et al April 1994 release Mit_cast: Dietrich et al April 1994 release Mit_dba2: Dietrich et al April 1994 release Mit_ob: Dietrich et al April 1994 release Mit_lp: Dietrich et al April 1994 release Mit_nod: Dietrich et al April 1994 release Mit_non: Dietrich et al April 1994 release Mit_spr: Dietrich et al April 1994 release Neighbor_cen: primary literature Neighbor_tel: Primary literature Panel_name: various sources Phenotype: data from MC Green 1989 and Peters Primer: Some data from Janan Eppig's database as published in Mammalian Genome 1992 3:300-430 or Mouse Genome 1992 90:599. MIT PCR primer sequences from the Oct 1993 release. Repeat_info: From MIT Database release 7 of July 20, 1994. RI data from Dr. R. Elliott, Roswell Park Cancer Institute. RI data from Dr. R. Elliott, Roswell Park Cancer Institute. Data release of March 94 with Map Manager program 2.5 from Dr. Kenneth Manly. RI data from Dr. R. Elliott, Roswell Park Cancer Institute. RI data from Dr. R. Elliott, Roswell Park Cancer Institute. RI data from Dr. R. Elliott, Roswell Park Cancer Institute. RI data from Dr. R. Elliott, Roswell Park Cancer Institute. RI data from Dr. R. Elliott, Roswell Park Cancer Institute. RI data from Dr. R. Elliott, Roswell Park Cancer Institute. RI data from Dr. R. Elliott, Roswell Park Cancer Institute. RI data from Dr. R. Elliott, Roswell Park Cancer Institute. RI data from Dr. R. Elliott, Roswell Park Cancer Institute. RI data from Dr. R. Elliott, Roswell Park Cancer Institute. RI data from Dr. R. Elliott, Roswell Park Cancer Institute. RI data from Dr. R. Elliott, Roswell Park Cancer Institute. RI data from Dr. R. Elliott, Roswell Park Cancer Institute. RI data from Dr. R. Elliott, Roswell Park Cancer Institute. Yac_mus: Primary literature Year: From various sources Sort_by_group: RW Sort_by_human_chr: RW Sort_by_human_sym: RW Status: Data primarily from GBASE July 1993 and Genetic Maps 6th ed 1993. 3/31/93 12/3/94 Jax_number: Jackson Laboratory reference number for a mutant mouse stock Accession_mgd A000003